| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RESEARCH REPORT |
1 Department of Oral and Maxillofacial Pathology, School of Dental Medicine, Tufts University, DHS-646A, One Kneeland Street, Boston, MA 02111-1527, USA;
2 Department of Oral Diagnostic Sciences, School of Dental Medicine, University at Buffalo, SUNY, Buffalo, NY, USA;
3 IMMCO Diagnostics, Inc., Buffalo, NY, USA;
4 Department of Periodontics and Oral Medicine, School of Dentistry, University of Michigan, Ann Arbor, MI; and
5 Departments of Microbiology and Dermatology, University at Buffalo, SUNY, Buffalo, NY, USA
* corresponding author, lynn.solomon{at}tufts.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: p63 • chronic ulcerative stomatitis • autoimmunity
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
CUS is one of several immunologically mediated conditions that affect the oral cavity, e.g., pemphigoid, pemphigus vulgaris, and lichen planus (Scully and Porter, 1997). Generally, these conditions are successfully managed with corticosteroid therapy (Gonzalez-Moles and Scully, 2005a), and treatment failures often result from incorrect diagnosis (Gonzalez-Moles and Scully, 2005b). In CUS, corticosteroids are less effective than other therapeutics, such as hydroxychloroquine (Chorzelski et al., 1998), underscoring the importance of accurate diagnosis. The histopathologic findings are non-specific, although suggestive features include atrophic, parakeratinized, stratified squamous epithelium, lichenoid inflammatory cell infiltrates, basal cell degeneration, and cytoid bodies (Solomon et al., 2003). Immunofluorescence studies have revealed the presence of autoantibodies with a stratified epithelial specific-antinuclear antibody (SES-ANA) pattern. These autoantibodies target an antigen, deltaNp63alpha, which is a nuclear protein normally present in basal and parabasal cells of stratified squamous epithelia (Lee et al., 1999).
DeltaNp63alpha is a member of a family of nuclear transcription factors, including p63, p73, and the p53 tumor suppressor gene, which share considerable sequence homology (Choi et al., 2002). The homology extends to protein structures, which are characterized by arrangement in functional domains. The N-terminus of domain 1 is generated from the transcriptional start codon and has a transactivating (TA) function. Domain 2 is a DNA-binding domain, while domain 3 is an oligomerization domain. Domain 4 includes the C-terminus. Additional complexity is introduced in p63 and p73 proteins by the production of several isoforms.
When an internal transcriptional start site is used, an N-terminal truncated isoform of domain 1 is created, indicated in writing as "deltaN". Alternate mRNA splicing produces C-termini of various lengths; the specific isoforms are indicated by the addition of a Greek letter suffix, e.g., alpha, beta, gamma. Currently, the convention is to refer to the p63/p73 family members by using the appropriate (TA or deltaN) prefix, and a Greek letter suffix, to identify specific isoforms.
Investigators in several fields independently described the antigen in CUS, deltaNp63alpha; thus, it is found in the literature under several different names (Schmale and Bamberger, 1997; Augustin et al., 1998; Osada et al., 1998; Senoo et al., 1998; Trink et al., 1998; Yang et al., 1998; Lee et al., 1999; Hibi et al., 2000). The p63 gene is located on chromosome 3q27-29 (Yang et al., 1998). The molecular mass of deltaNp63alpha is approximately 70 kDa, and the cDNA has a 1761-bp open reading frame [GenBank accession #AF091627, National Center for Biotechnology Information (NCBI), http://www.ncbi.nlm.nih.gov/]. Various isoforms of p63 are expressed in a tissue-specific manner (Dellavalle et al., 2001).
The present study was undertaken to characterize the autoimmune response in CUS and to provide a potential diagnostic rationale for the use of these autoantibodies. Molecular methods were applied in our study to examine the autoantibody isotype, immunogenic functional domains of the deltaNp63alpha antigen, and cross-reactivity with homologous p53, p73, and p63 proteins.
|
MATERIALS & METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Primer Design and PCR Amplification of deltaNp63alpha and Domains
The source of cloned deltaNp63alpha and primer design for PCR amplification of full-length deltaNp63alpha protein have been previously described (Solomon et al., 2003). Functional domain sequences of deltaNp63alpha were identified by comparison with functional domain sequences of p53 (Yang et al., 1998; Lee et al., 1999; Levrero et al., 1999). The nucleotide (nt) numbers of the deltaNp63alpha domains are: domain 1, nt #’s 1-79/domain 2, nt #’s 80-275/domain 3, nt #’s 276-385/domain 4, nt #’s 386-587.
Primer sets were designed for PCR amplification of functional domains: domain 1F (5'-GGATCCTAATACGACTCACTAT AGGGAACAGCTAACATGTTGTACCTGGAA-3') and domain 1R (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAC TTTTTCTTACAGCTAACATGTTGTACCTGGAA-3'); domain 2F (5'-GGATCCTAATACGACTCACTATAGGGAACAG CTAACATGCCGCACAGTTTCGACGTGTCCT-3') and domain 2R (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACTTT GTACTGTCCGAAACTTGCTG-3'); domain 3F (5'-GGATCCTAATACGACTCACTATAGGGAACAGCTAACATG CCGCACAGTTTCGACGTGTCCT-3') and domain 3R (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACTTTGTACTG TCCGAAACTTGCTG-3'; domain 4F (5'-GGATCCTAATA CGACTCACTATAGGGAACAGCTAACATGACAGCTAACAT GTTGTACCTGGAA-3') and domain 4R (5'-TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTCACTCCCCCTCCTCTTTGATGC-3').
Incorporation of transcription and poly A translational signaling sequences, e.g., the oligo dT stretch (Beckler et al., 2000), resulted in a primer length longer than usual. Gel-purified primers (Integrated DNA Technologies, Coralville, IA, USA) and AccuPrimeTM Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) were used in a GeneAmp® thermal-cycler (PE Applied Biosystems, Foster City, CA, USA) as per manufacturers’ instructions under standard conditions (Saiki, 1990). Combination domains—1&2, 2&3, 3&4, 1,2&3, and 2,3&4—were created with appropriate primers.
In vitro Transcription/Translation (IVTT)
We used the TNT® T7 Quick for PCR DNA System, TranscendTM Biotinylated tRNA (Promega Corporation, Madison, WI, USA) and PCR-amplified DNA to produce biotinylated full-length deltaNp63alpha and functional domains in rabbit reticulocyte lysate (Weinhofer et al., 2002). SDS-PAGE and Western blot with streptavidin/alkaline phosphatase (Promega) and Western Blue® Alkaline Phosphatase Substrate (Promega) demonstrated successful production of biotinylated proteins.
Western Immunoblot
For identification of immunologic reactivity, IVTT-produced proteins were immunoblotted (Targoff et al., 1993) with human sera (1:50 dilution) or anti-human p63 monoclonal antibody 4A4 (1:500 dilution) (Oncogene Research Products, San Diego, CA, USA). Alkaline phosphatase-conjugated 2° antibodies (1:1000 dilution) were either: Donkey Anti-Human IgG (H+L) AffiniPure F(ab')2 Fragment (cat. #709-056-149), Goat Anti-Human Serum IgA, 
-chain-specific (cat. #109-056-011), or Goat Anti-Mouse IgG (H+L) AffiniPure (cat. #115-055-062), all from the same source (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Western Blue® Substrate for Alkaline Phosphatase (Promega) was used to develop color.
Immunoprecipitation
Approximately 45 ng of biotinylated IVTT-produced protein was incubated with serum from individual patients. Full-length deltaNp63alpha, domains 1, 2, 3, and 4, and combination domains 1&2, 2&3, and 3&4 were tested individually. Antibody-bound proteins were precipitated with Immunopure Immobilized Protein L Gel (Pierce Biotechnology, Rockford, IL, USA) (Tominaga et al., 2001) and separated by SDS-PAGE. After electrotransfer to nitrocellulose membranes and incubation with streptavidin/alkaline phosphatase (Promega), color was developed with Western Blue® Substrate for Alkaline Phosphatase (Promega).
Cross-reactivity of CUS Patient Antibodies with p53, p63, and p73 Isoforms
Cloned p53 was obtained from Drs. David Sidransky and Edward Ratovitsky (Johns Hopkins University, Baltimore, MD, USA). Cloned TAp63alpha was obtained from Drs. Frank McKeon and Annie Yang (Harvard Medical School, Boston, MA, USA). Clones of TAp73alpha, TAp73gamma, TAp73delta, deltaNp73alpha, deltaNp73beta, and deltaNp73gamma were obtained from Dr. Gerry Melino (University of Rome, Italy). TNT® T7 Quick Coupled Transcription/Translation System for Plasmid DNA (Promega) and TranscendTM Biotinylated tRNA (Promega) were used to produce biotinylated proteins directly from plasmids (Bazzoni et al., 2000).
Proteins were subjected to SDS-PAGE, electrotransferred to nitrocellulose membranes, and incubated with streptavidin/alkaline phosphatase and substrate to demonstrate successful IVTT. For detection of immunologic reactivity, duplicate membranes were immunoblotted with human sera (1:50 dilution). After being washed, membranes were incubated with alkaline phosphatase-conjugated donkey anti-human IgG secondary antibody (Jackson Laboratories) and subsequently with Western Blue® Substrate for Alkaline Phosphatase (Promega).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). However, donkey anti-human IgG (H+L) secondary antibody also reacts with IgM and IgA, which share light chains; thus we cannot conclude that the patient antibodies are exclusively IgG. Immunoblotting with IgA isotype-specific secondary antibody showed that 52% of the sera were positive, and 48% were negative for IgA antibodies to deltaNp63alpha (Fig., B). None of the control sera was immunologically reactive with deltaNp63alpha (Fig., C). Positive results were identified based on visual detection of a reactive band.
|
). Functional domain combinations served to confirm results of the individual domains. Domain 1 is a small peptide and did not express well in IVTT; thus it was unable to be tested individually. However, since 5 of 6 sera tested recognized combination domains 1&2, and none recognized domain 2, it is reasonable to assume that domain 1 must be the antigenic epitope. These results show that the antigenic epitopes of linearized peptides are domains 1 and 4, the N- and C-termini, respectively.
|
) shows that all CUS sera strongly recognized domain 2 and combination domain 1&2 in folded conformations. Only 1 of 8 sera showed weak positive recognition of domain 3. Domain 4 was strongly recognized by 2 sera, and 5 sera produced a weak band. Of 8 samples tested, 3 recognized combination domains 3&4 with a strong band, and 3 produced a weak band. Domain 1 was unable to be tested individually. These results indicate that folded domain 2 is the most strongly antigenic epitope. Folded domain 4 is also antigenic, although not as strongly or frequently.
|
) shows that all CUS sera tested were immunologically reactive with the p63 isoform TAp63alpha. Two sera recognized additional isoforms, one recognizing TAp73alpha and delta-Np73alpha, while the other reacted with the TAp73gamma isoform. One serum was extremely cross-reactive, recognizing all p73 and p63 isoforms tested, although it did not recognize p53. The secondary antibody used, donkey anti-human IgG (H+L), also reacts with IgM and IgA, which share light chains; thus we cannot conclude that the patient antibodies are exclusively IgG. Ten duplicate blots were created for controls; all control sera were negative for immunologic reactivity with any of the isoforms (data not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In vitro systems employed to produce proteins used rabbit reticulocyte lysates, because they produce appropriate mammalian-type post-translational protein modification and folding. The IVTT-produced proteins were biotinylated to aid detection, and it is possible that addition of this small molecule may have affected epitope reactivity. Thus, our results should be confirmed with an independent method to determine immunogenic epitopes conclusively.
Immunological reactivity to deltaNp63alpha was shown with all sera examined by immunoblotting. The presence of IgA antibodies in CUS patient sera has not previously been studied, and 52% of samples had circulating IgA immunoreactive with deltaNp63alpha. In mucous membrane pemphigoid, circulating IgA is clinically significant; patients with dual circulating IgG and IgA responses have more severe disease (Setterfield et al., 1998). Future studies to determine if CUS patients with circulating IgA have disease clinically more severe would be useful.
Linear epitopes are detected by immunoblot, and conformational epitopes are detected by immunoprecipitation. Immunoblotting confirmed antibodies to linearized epitopes of functional domains 1 and 4. In contrast, immunoprecipitation showed that the most strongly immunogenic region was a conformational epitope of functional domain 2. It is not unexpected that multiple epitopes are recognized, since the normal immune response is polyclonal. The tissue milieu in CUS is inflammatory, and proteins are degraded; thus, linear sequences, in addition to conformational epitopes, may become immunogenic.
This work is the first to examine cross-reactivity of CUS patient antibodies with p53 family isoforms. DeltaNp63alpha exhibits various homologies to other p53, p63, and p73 proteins. p53 and p63 share 60% and 37% identical residues in functional domains 2 and 3, respectively (Barbieri and Pietenpol, 2006). Amino acid sequence comparison between p63alpha and p73alpha shows 85%, 60%, and 50% homology between functional domains 2, 3, and 4, respectively (Yang et al., 2002). All CUS sera tested cross-reacted with TAp63alpha, which is not surprising, since there is only a small N-terminal difference between TA- and deltaN- p63alpha. Most sera exhibited limited cross-reactivity to p63 and 73 isoforms, while none cross-reacted with p53.
DeltaNp63alpha is the p63 isoform preferentially expressed in stratified squamous epithelia, where it is essential for differentiation (Koster et al., 2004) and the maintenance of progenitor cell populations to sustain development, morphogenesis, and the proliferative potential (Ratovitski et al., 2001; Marchbank et al., 2003; Barbieri and Pietenpol, 2006). Homology between p53 family members allows for binding to consensus DNA sequences (Yang et al., 2002), and deltaN isoforms exert dominant-negative effects over p53, p63, and p73 activities (Murray-Zmijewski et al., 2006). Another p63 function is maintenance of epithelial integrity via regulation of desmosomal adhesion complex stability (Ihrie et al., 2005).
While CUS patient antibodies to deltaNp63alpha are demonstrated within basal cell nuclei in vivo, their role in pathogenesis is unknown. Several studies support the intracellular and intranuclear penetration of antibodies, although not without controversy (Alarcon-Segovia et al., 1996; Reichlin, 1998; Rivadeneyra-Espinoza and Ruiz-Arguelles, 2006). It is interesting to speculate that CUS autoantibodies to the DNA-binding domain may interfere with the ability of deltaNp63alpha to oppose apoptosis and maintain epithelial integrity. This may be especially significant in the oral cavity, where epithelial turnover is high, and the site is frequently exposed to minor trauma.
These results have importance when one considers that, currently, the gold standard in diagnosis of immunologically mediated conditions is immunofluorescence. The facilities to perform these studies are limited, and the tests are costly. As a result, many oral ulcerative conditions are treated empirically, without a diagnosis; thus, the true incidence and prevalence of many of these conditions, including CUS, are unknown. Future development of a simple immunoassay may help to establish the true incidence and prevalence of CUS and allow for meaningful comparisons of treatment efficacies.
|
ACKNOWLEDGMENTS |
|---|
Received March 6, 2006; Last revision February 20, 2007; Accepted April 15, 2007
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Augustin M, Bamberger C, Paul D, Schmale H (1998). Cloning and chromosomal mapping of the human p53-related KET gene to chromosome 3q27 and its murine homolog Ket to mouse chromosome 16. Mamm Genome 9:899–902.[ISI][Medline]
Barbieri CE, Pietenpol JA (2006). p63 and epithelial biology. Exp Cell Res 312:695–706.[ISI][Medline]
Bazzoni G, Martinez-Estrada OM, Orsenigo F, Cordenonsi M, Citi S, Dejana E (2000). Interaction of junctional adhesion molecule with the tight junction components ZO-1, cingulin, and occludin. J Biol Chem 275:20520–20526.
Beckler G, Zwick M, Hurst R, Stupfel J, Drewieck M, Godat B, et al. (2000). A new TNT system for enhanced expression of PCR DNA. Promega Notes 74:10–13.
Choi HR, Batsakis JG, Zhan F, Sturgis E, Luna MA, El-Naggar AK (2002). Differential expression of p53 gene family members p63 and p73 in head and neck squamous tumorigenesis. Hum Pathol 33:158–164.[ISI][Medline]
Chorzelski TP, Olszewska M, Jarzabek-Chorzelska M, Jablonska S (1998). Is chronic ulcerative stomatitis an entity? Clinical and immunological findings in 18 cases. Eur J Dermatol 8:261–265.[ISI][Medline]
Dellavalle RP, Egbert TB, Marchbank A, Su LJ, Lee LA, Walsh P (2001). CUSP/p63 expression in rat and human tissues. J Dermatol Sci 27:82–87.[ISI][Medline]
Gonzalez-Moles MA, Scully C (2005a). Vesiculo-erosive oral mucosal disease—management with topical corticosteroids: (1) fundamental principles and specific agents available. J Dent Res 84:294–301.
Gonzalez-Moles MA, Scully C (2005b). Vesiculo-erosive oral mucosal disease—management with topical corticosteroids: (2) protocols, monitoring of effects and adverse reactions, and the future. J Dent Res 84:302–308.
Hibi K, Trink B, Patturajan M, Westra WH, Caballero OL, Hill DE, et al. (2000). AIS is an oncogene amplified in squamous cell carcinoma. Proc Natl Acad Sci USA 97:5462–5467.
Ihrie RA, Marques MR, Nguyen BT, Horner JS, Papazoglu C, Bronson RT, et al. (2005). Perp is a p63-regulated gene essential for epithelial integrity. Cell 120:843–856.[ISI][Medline]
Koster MI, Kim S, Mills AA, DeMayo FJ, Roop DR (2004). p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev 18:126–131.
Lee LA, Walsh P, Prater CA, Su LJ, Marchbank A, Egbert TB, et al. (1999). Characterization of an autoantigen associated with chronic ulcerative stomatitis: the CUSP autoantigen is a member of the p53 family. J Invest Dermatol 113:146–151.[ISI][Medline]
Levrero M, De Laurenzi V, Costanzo A, Gong J, Melino G, Wang JY (1999). Structure, function and regulation of p63 and p73. Cell Death Differ 6:1146–1153.[ISI][Medline]
Marchbank A, Su LJ, Walsh P, DeGregori J, Penheiter K, Grayson TB, et al. (2003). The CUSP DeltaNp63alpha isoform of human p63 is downregulated by solar-simulated ultraviolet radiation. J Dermatol Sci 32:71–74.[ISI][Medline]
Murray-Zmijewski F, Lane DP, Bourdon JC (2006). p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ 13:962–972.[ISI][Medline]
Osada M, Ohba M, Kawahara C, Ishioka C, Kanamaru R, Katoh I, et al. (1998). Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat Med 4:839–843.[ISI][Medline]
Ratovitski EA, Patturajan M, Hibi K, Trink B, Yamaguchi K, Sidransky D (2001). p53 associates with and targets Delta Np63 into a protein degradation pathway. Proc Natl Acad Sci USA 98:1817–1822.
Reichlin M (1998). Cellular dysfunction induced by penetration of autoantibodies into living cells: cellular damage and dysfunction mediated by antibodies to dsDNA and ribosomal P proteins. J Autoimmun 11:557–561.[ISI][Medline]
Rivadeneyra-Espinoza L, Ruiz-Arguelles A (2006). Cell-penetrating anti-native DNA antibodies trigger apoptosis through both the neglect and programmed pathways. J Autoimmun 26:52–56.[ISI][Medline]
Saiki RK (1990). Amplification of genomic DNA. In: PCR protocols: a guide to methods and applications. Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. San Diego: Academic Press, pp. 13–20.
Schmale H, Bamberger C (1997). A novel protein with strong homology to the tumor suppressor p53. Oncogene 15:1363–1367.[ISI][Medline]
Scully C, Porter SR (1997). The clinical spectrum of desquamative gingivitis. Semin Cutan Med Surg 16:308–313.[ISI][Medline]
Senoo M, Seki N, Ohira M, Sugano S, Watanabe M, Inuzuka S, et al. (1998). A second p53-related protein, p73L, with high homology to p73. Biochem Biophys Res Commun 248:603–607.[ISI][Medline]
Setterfield J, Shirlaw PJ, Kerr-Muir M, Neill S, Bhogal BS, Morgan P, et al. (1998). Mucous membrane pemphigoid: a dual circulating antibody response with IgG and IgA signifies a more severe and persistent disease. Br J Dermatol 138:602–610.[ISI][Medline]
Solomon LW, Aguirre A, Neiders M, Costales-Spindler A, Jividen GJ Jr, Zwick MG, et al. (2003). Chronic ulcerative stomatitis: clinical, histopathologic, and immunopathologic findings. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 96:718–726.[ISI][Medline]
Targoff IN, Trieu EP, Miller FW (1993). Reaction of anti-OJ autoantibodies with components of the multi-enzyme complex of aminoacyl-tRNA synthetases in addition to isoleucyl-tRNA synthetase. J Clin Invest 91:2556–2564.[ISI][Medline]
Tominaga O, Unsal K, Zalcman G, Soussi T (2001). Detection of p73 antibodies in patients with various types of cancer: immunological characterization. Br J Cancer 84:57–63.[ISI][Medline]
Trink B, Okami K, Wu L, Sriuranpong V, Jen J, Sidransky D (1998). A new human p53 homologue. Nat Med 4:747–748.[ISI][Medline]
Weinhofer I, Forss-Petter S, Zigman M, Berger J (2002). Cholesterol regulates ABCD2 expression: implications for the therapy of X-linked adrenoleukodystrophy. Hum Mol Genet 11:2701–2708.
Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dotsch V, et al. (1998). p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 2:305–316.[ISI][Medline]
Yang A, Kaghad M, Caput D, McKeon F (2002). On the shoulders of giants: p63, p73 and the rise of p53. Trends Genet 18:90–95.[ISI][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| IADR Journals | Advances in Dental Research ® |
| Journal of Dental Research ® | Critical Reviews (1990-2004) |
Np63