| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RESEARCH REPORT |
Department of Pediatric Dentistry, Dental School, University of Texas Health Science Center San Antonio, MSC 7888, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900, USA; and
1 Department of Growth & Development, Pediatric Dentistry Division, School of Dentistry, University of California San Francisco, San Francisco, CA;
* corresponding author, macdougall{at}uthscsa.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: amelogenin • ameloblasts • odontoblasts • alternative splicing • exons 8 and 9
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Amelogenins are critical for normal enamel formation, as has been demonstrated by human genetics and experimental laboratory studies (Hart et al., 2000; Gibson et al., 2001; Greene et al., 2002; Paine et al., 2002; Li et al., 2003). In addition, recent in vivo and in vitro studies have suggested that amelogenin proteins might have signaling potential for instructing epithelial and mesenchymal cells during tooth development (Zeichner-David, 2001; Veis, 2003). In particular, it has been suggested that the inclusion or exclusion of amelogenin exon 4 can specifically direct changes in the phenotype of the rat muscle fibroblast toward acquiring osteogenic or chondrogenic potential (Veis et al., 2000). Therefore, full characterization of amelogenin-spliced isoforms would provide the foundation for understanding the biological roles of the various amelogenin peptides.
The goal of this study was to: (1) determine potential mouse amelogenin exon 8/9 sequences; (2) characterize the alternative spliced isoforms of amelogenin exons 8–9; and (3) immunolocalize amelogenin exons 8/9 encoded proteins during tooth development. These findings will help to delineate the mechanisms of enamel formation and mineralization as directed by the major group of extracellular matrix proteins.
|
MATERIALS & METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Hemi-mandibles of newborn and four-day-old Swiss mice were micro-dissected, washed in PBS for 10 min, fixed overnight in 10% buffered formalin, and demineralized in formic acid for 3–5 days. Tissues were paraffin-embedded, and 5-micron sections were prepared. All animal experiments were approved by the IACUC and were carried out under the NIH guidelines for proper animal handling.
RT-PCR
Specific AMEL forward primers were designed based on a published mouse sequence (GenBank: NM_009666) from exon 2 (5' AACCATCAAGAAATGGGGACC 3') and exon 5 (5' CTTACCCCTTTGAAGTGTA 3'). AMEL exon 9 reverse primer (5' ACTACATGCCATTGTGTTCTG 3') was designed based on the rat AMEL sequence (Li et al., 1998). PCR amplification was performed (95°C, 5 min; 35 cycles of 95°C-1 min/52°C-2 min/72°C-1 min; 72°C, 10 min), and products were separated on 1% agarose gels, subcloned, and sequenced (UTHSCSA/DNA sequencing core, ABI-3100 Genetic Analyzer, Foster City, CA, USA). Sequences were analyzed with the use of a MacVector sequence analysis program.
Immunohistochemistry
Tooth sections of post-natal mouse and dental and fibroblast cell cultures were incubated with polyclonal (1:200) rabbit anti-rat exons 8/9 peptide antibody (RHPLNMETTTEK) (Li et al., 1998; Baba et al., 2002) and processed with a goat anti-rabbit antibody linked to a peroxidase-anti-peroxidase (PAP system, Dako, USA), as previously described (Papagerakis et al., 2002). Immunohistochemistry negative controls were also performed by omission of the primary antibody. The reaction was detected with DAB chromogen processing and tissues counterstained with hemotoxylin. Sections were examined and photographed with a Zeiss Axioplan microscope.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). These fragments were subcloned, and the sequence was determined.
|
). The large fragment (750 bp) contained amelogenin exons 2, 3, 5, 6, 8, and 9, while the 350-bp product contained exons 2, 3, 5, partial 6 (6D), 8, and 9. Both fragments lacked exons 4 and 7 and differed only in the partial omission of exon 6. Exons 8 and 9 consisted of a total of 119 bp (Fig. 1) and were always found together. Due to the presence of an internal stop codon within exon 9, the putative translation of mouse exons 8 and 9 would result in a peptide segment of 24 amino acids. This putative protein sequence (GenBank accession # AAW28903 shares 87% identity with the previously deduced rat sequence (Li et al., 1998), varying by only 3 amino acids (Fig. 1). Moreover, using the BLAST program against the mouse genome, we have characterized the AMELX intron sequence and length among exons 6, 8, and 9 (Table).
|
, 2B) and the MO6-G3 odontoblast (Fig. 2C) mouse cell lines were used. NIH-3T3 cells were negative (not shown). In developing mouse tissues, amelogenin 8/9 expression ranged from little or no expression (within the undifferentiated inner enamel epithelium) to high expression [associated with pre-ameloblasts (Fig. 2E), differentiated ameloblasts (Fig. 2F), and post-secretory ameloblasts (Fig. 2G)], to a complete loss of expression [associated with maturation stage cells (Figs. 2I–2M)]. In addition, staining was observed in the stratum intermedium cells associated with early stages of amelogenesis (Fig. 2E). Young odontoblasts clearly exhibited expression of amelogenin exons 8/9 peptides (Figs. 2E, 2F). In contrast, pre-odontoblasts (Fig. 2E) and mature odontoblasts (Figs. 2I–2M) were devoid of detectable staining. Within the enamel matrix, a strong biphasic pattern of staining was observed (Figs. 2J, 2K). Immunostaining was first concentrated at the dentino-enamel junction (Fig. 2J). Later, a second phase of intense staining was observed close to the ameloblast cell layer (Figs. 2J, 2K). No staining was seen after omission of the primary antibody (Figs. 2D, 2H).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
AMELX contains 7 exons encoding for a 196-amino-acid protein in mice and rats. Recently, Li et al.(1998) described an alternative 3' end rat transcript due to the presence of 2 additional exons downstream of exon 7. However, no sequence information has been provided for the human or mouse gene. Our study, in which we used RT-PCR and a tooth cDNA library or dental cell cDNAs, identified 2 major AMELX transcripts containing mouse amelogenin exons 8 and 9. Sequence analysis was performed and showed that the largest amplicon contained exons 2, 3, 5, 6, 8, and 9, with exons 4 and 7 being alternatively spliced. In contrast, the small amplicon contained exons 2, 3, 5, 6D, 8, and 9, with exons 4, 7, and a large part of exon 6 (6A-C) being spliced. In addition, a third newly characterized alternative spliced isoform has been isolated, with both exons 3 and 4 being deleted. In summary, 3 new alternative spliced forms have been characterized, adding to the complexity of amelogenin isoforms expressed during odontogenesis. The specific role of these alternative spliced isoforms remains to be determined.
Many studies of splicing mechanisms have focused upon the basis for splice boundary selection for AMELX (for review, see Yuan et al., 2001). Amelogenin relative splicing potential depends on intron/exon sequence composition and length (Yuan et al., 2001). Here, exons 8 and 9 were always found transcribed together. Furthermore, intron regions, at the borders of exons 6, 8, and 9, important for binding of the splicing machinery, were highly conserved between species (personal communication), suggesting that optimal exon inclusion conditions exist for both exons 8 and 9.
Exon 4 is the most commonly spliced (99%) exon (Simmer, 1994). It has been suggested that the inclusion or exclusion of amelogenin exon 4 may have a role in progenitor fibroblast cell differentiation (Veis et al., 2000). Our study failed to isolate cDNAs containing exon 4. It should be noted that some RT-PCR experiments resulted in a faint product with the expected size of a mouse amelogenin exon 8/9 full-length transcript. Further investigations are necessary to clarify the inclusion or exclusion of amelogenin exon 4 from AMEL exons 8/9 containing transcripts, as well as their potential function(s) during tooth development.
In addition to the exclusion of exon 4, exon 7 was also absent from all transcripts containing exons 8 and 9. Amelogenin exon 7 contains a stop codon and poly (A) signal and is detected in all mouse AMEL cDNAs previously characterized (Simmer, 1994). The newly characterized exon 9 also contains a stop codon and poly (A) signal similar to those of exon 7 (this study), strongly suggesting that 2 alternative COOH-terminals exist for mouse and rat AMELX transcripts. However, the biological consequences of the alternative use between the 2 COOH-terminals need to be clarified.
Immunolocalization was performed and showed that amelogenin 8/9 transcripts are translated into proteins in mouse tooth organs. Very intense staining was detected in early ameloblast cytodifferentiation; however, as secretory ameloblasts transitioned to mature ameloblasts, expression levels dramatically decreased to undetectable levels. In contrast to results reported in a previous study (Baba et al., 2002), our study also revealed staining in the mouse stratum intermedium cells (SI), not generally associated with amelogenin expression. Technical differences between the 2 studies may explain these results. Our data, showing amelogenin expression by SI cells, are supported by in vivo bovine AMELX promoter studies with the ß-galactosidase reporter gene (Chen et al., 1994) and RNA studies that used in situ hybridization (Papagerakis et al., 2003). The function of amelogenin in the SI is not known and perhaps is related to cell signaling.
Our results also demonstrated amelogenin exons 8/9-protein expression in young odontoblasts. Until recently, the localization of amelogenin was strictly confined to the ameloblasts, but novel evidence has showed amelogenin expression in porcine and rat odontoblasts (Veis et al., 2000; Papagerakis et al., 2003). Similarly, recombinant amelogenin M179 antibody (corresponding to exons 2–6) reacted positively within secretory-stage ameloblasts and weakly within odontoblasts during normal (Diekwisch et al., 2002) and pathological (Goldberg et al., 2002) tooth development. Our study demonstrated that amelogenin 8/9 mRNA and proteins are also transiently expressed by odontoblasts. Interestingly, similar alternative spliced profiles were found in odontoblasts and ameloblasts cells, suggesting that amelogenin alternative splicing is not cell-type-specific, as has also previously been suggested (Veis et al., 2000; Papagerakis et al., 2003; this study).
Results from our study differ from the previously reported data describing that exon 7 COOH-terminal specific immunoreactivity was detected only at the outer layer of the immature layer of enamel (Uchida et al., 1991). This pattern has been attributed to rapid COOH-terminal proteolytic cleavage following amelogenin secretion into the enamel matrix (Brookes et al., 1995; Moradian-Oldak et al., 2001; Simmer and Hu, 2002). Analysis of our data clearly shows intense staining at the enamel-dentin junction and in the newly formed enamel proximal to the ameloblasts. The new COOH-terminal conferred by alternative splicing with exons 8/9, reported here, is apparently not being cleaved in the same manner as proteins containing the exon 7 COOH-terminal. Our study suggests that exons 8/9 COOH-terminal might have unique functions related to different matrix compartments of the developing enamel.
Amelogenins self-assemble within the matrix to form nanospheres and interact with the crystal surfaces in this form (Paine et al., 2003; Shaw et al., 2004). It has also been suggested that the COOH- and NH2-terminals have different roles to play in this respect (Paine et al., 2003; Shaw et al., 2004), with the COOH-terminal at the exterior of the nanosphere. A quick comparison between exons 7 and 8/9 COOH-terminal sequences reveals that the exons 8/9 splice variant would have a less charged terminal compared with that of the exon 7 product. Analysis of these data suggests that the exons 8/9 COOH-terminal may have a different localization within the nanospheres, as well as a different affinity to hydroxyapatite and different ability to inhibit crystal growth. Additional studies are needed to evaluate the properties and potential roles of amelogenin exons 8/9 proteins in enamel formation and maturation.
The newly characterized exons 8 and 9 may play important role(s) in enamel biomineralization and/or epithelial mesenchymal interactions during tooth development. However, it is not yet known if combinations of exclusion/inclusion of exons 4 and 6A-C may influence the potential role(s) of exons 8 and 9. The sequence information and alternative spliced profiles obtained in this investigation will be important for further evaluation of the functional significance of peptides produced from these novel exons.
|
ACKNOWLEDGMENTS |
|---|
Received August 23, 2004; Last revision March 4, 2005; Accepted April 8, 2005
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Brookes SJ, Robinson S, Kirkham J, Bonass WA (1995). Biochemistry and molecular biology of amelogenin proteins of developing dental enamel. Arch Oral Biol 40:1–14.[ISI][Medline]
Chen E, Piddington R, Decker S, Park J, Yuan ZA, Abrams WR, et al. (1994). Regulation of amelogenin gene expression during tooth development. Dev Dyn 199:189–198.[ISI][Medline]
Diekwisch TG, Berman BJ, Anderton X, Gurinsky B, Ortega AJ, Satchell PG, et al. (2002). Membranes, minerals, and proteins of developing vertebrate enamel. Microsc Res Tech 59:373–395.[ISI][Medline]
Gibson CW, Yuan ZA, Hall B, Longenecker G, Chen E, Thyagarajan T, et al. (2001). Amelogenin-deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 276:31871–31875.
Goldberg M, Septier D, Rapoport O, Young M, Ameye L (2002). Biglycan is a repressor of amelogenin expression and enamel formation: an emerging hypothesis. J Dent Res 81:520–524.
Greene SR, Yuan ZA, Wright JT, Amjad H, Abrams WR, Buchanan JA, et al. (2002). A new frameshift mutation encoding a truncated amelogenin leads to X-linked amelogenesis imperfecta. Arch Oral Biol 47:211–217.[ISI][Medline]
Hart S, Hart T, Gibson C, Wright JT (2000). Mutational analysis of X-linked amelogenesis imperfecta in multiple families. Arch Oral Biol 45:79–86.[ISI][Medline]
Li R, Li W, DenBesten PK (1995). Alternative splicing of amelogenin mRNA from rat incisor ameloblasts. J Dent Res 74:1880–1885.
Li W, Matthews C, Gao C, DenBesten PK (1998). Identification of two additional exons at the 3 end of the amelogenin gene. Arch Oral Biol 43:497–504.[ISI][Medline]
Li W, Gao C, Yan Y, DenBesten P (2003). X-linked amelogenesis imperfecta may result from decreased formation of tyrosine rich amelogenin peptide (TRAP). Arch Oral Biol 48:177–183.[ISI][Medline]
MacDougall M, Thiemann F, Ta H, Hsu P, Chen SL, Snead ML (1995). Temperature sensitive simian virus 40 large T antigen immortalization of murine odontoblast cell cultures: establishment of clonal odontoblast cell line. Connect Tissue Res 33:97–103.[Medline]
MacDougall M, Simmons D, Luan X, Nydegger J, Feng J, Gu TT (1997). Dentin phosphoprotein and dentin sialoprotein are cleavage products expressed from a single transcript coded by a gene on human chromosome 4. Dentin phosphoprotein DNA sequence determination. J Biol Chem 272:835–842.
Moradian-Oldak J, Jimenez I, Maltby D, Fincham AG (2001). Controlled proteolysis of amelogenins reveals exposure of both carboxy- and amino-terminal regions. Biopolymers 58:606–616.[ISI][Medline]
Paine ML, Lei YP, Dickerson K, Snead ML (2002). Altered amelogenin self-assembly based on mutations observed in human X-linked amelogenesis imperfecta (AIH1). J Biol Chem 277:17112–17116.
Paine ML, Wang HJ, Snead ML (2003). Amelogenin self-assembly and the role of the proline located within the carboxyl-teleopeptide. Connect Tissue Res 44(Suppl 1):52–57.
Papagerakis P, Peuchmaur M, Hotton D, Ferkdadji L, Delmas P, Sasaki S, et al. (1999). Aberrant gene expression in epithelial cells of mixed odontogenic tumors. J Dent Res 78:20–30.
Papagerakis P, Berdal A, Mesbah M, Peuchmaur M, Malaval L, Nydegger J, et al. (2002). Investigation of osteocalcin, osteonectin and dentin sialophosphoprotein in developing human teeth. Bone 30:377–385.[Medline]
Papagerakis P, MacDougall M, Hotton D, Bailleul-Forestier I, Oboeuf M, Berdal A (2003). Expression of amelogenin in odontoblasts. Bone 32:228–240.[Medline]
Sasaki S, Shimokawa H (1995). The amelogenin gene. Int J Dev Biol 39:127–133.[ISI][Medline]
Shaw WJ, Campbell AA, Paine ML, Snead ML (2004). The COOH terminus of the amelogenin, LRAP, is oriented next to the hydroxyapatite surface. J Biol Chem 279:40263–40266.
Simmer JP (1994). Alternative splicing of amelogenins. Connect Tissue Res 32:131–136.
Simmer JP, Hu JC (2002). Expression, structure, and function of enamel proteinases. Connect Tissue Res 43:441–449.[ISI][Medline]
Uchida T, Tanabe T, Fukae M, Shimizu M, Yamada M, Miake K, et al. (1991). Immunochemical and immunohistochemical studies, using antisera against porcine 25 kDa amelogenin, 89 kDa enamelin and the 13–17 kDa nonamelogenins, on immature enamel of the pig and rat. Histochemistry 96:129–138.[ISI][Medline]
Veis A (2003). Amelogenin gene splice products: potential signaling molecules. Cell Mol Life Sci 60:38–55.[ISI][Medline]
Veis A, Tompkins K, Alvares K, Wei K, Wang L, Wang XS, et al. (2000). Specific amelogenin gene splice products have signaling effects on cells in culture and in implants in vivo. J Biol Chem 275:41263–41272.
Wurtz T, Lundmark C, Christersson C, Bawden JW, Slaby I, Hammarström L (1996). Expression of amelogenin mRNA sequences during development of rat molars. J Bone Miner Res 11:125–131.[ISI][Medline]
Yuan Z, Chen E, Gibson CW (2001). Model system for alternative splicing: exon skipping. DNA Cell Biol 20:807–813.[ISI][Medline]
Zeichner-David M (2001). Is there more to enamel matrix proteins than biomineralization? Matrix Biol 20:307–316.[ISI][Medline]
Zeichner-David M, Diekwisch T, Fincham A, Lau E, MacDougall M, Moradian-Oldak J, et al. (1995). Control of ameloblast differentiation. Int J Dev Biol 39:69–92.[ISI][Medline]
This article has been cited by other articles:
|
|
 |
|
  Y. Li, C. Suggs, J. T. Wright, Z.-a. Yuan, M. Aragon, H. Fong, D. Simmons, B. Daly, E. E. Golub, G. Harrison, et al. Partial Rescue of the Amelogenin Null Dental Enamel Phenotype J. Biol. Chem., May 30, 2008; 283(22): 15056 - 15062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T.Q. Le, Y. Zhang, W. Li, and P.K. DenBesten The Effect of LRAP on Enamel Organ Epithelial Cell Differentiation J. Dent. Res., November 1, 2007; 86(11): 1095 - 1099. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.W. Gibson, Z.A. Yuan, Y. Li, B. Daly, C. Suggs, M.A. Aragon, F. Alawi, A.B. Kulkarni, and J.T. Wright Transgenic Mice that Express Normal and Mutated Amelogenins J. Dent. Res., April 1, 2007; 86(4): 331 - 335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Xu, H. Harada, and A. Taniguchi The Exon 6ABC Region of Amelogenin mRNA Contribute to Increased Levels of Amelogenin mRNA through Amelogenin Protein-enhanced mRNA Stabilization J. Biol. Chem., October 27, 2006; 281(43): 32439 - 32444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.D. Bartlett, R. L. Ball, T. Kawai, C.E. Tye, M. Tsuchiya, and J.P. Simmer Origin, splicing, and expression of rodent amelogenin exon 8. J. Dent. Res., October 1, 2006; 85(10): 894 - 899. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| IADR Journals | Advances in Dental Research ® |
| Journal of Dental Research ® | Critical Reviews (1990-2004) |
