JDR JDR Most Read Articles
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwasaki, K.
Right arrow Articles by Ganss, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwasaki, K.
Right arrow Articles by Ganss, B.
J Dent Res 84(12):1127-1132, 2005
© 2005 International and American Associations for Dental Research


RAPID COMMUNICATION
Biological

Amelotin—a Novel Secreted, Ameloblast-specific Protein

K. Iwasaki1,3, E. Bajenova1, E. Somogyi-Ganss2, M. Miller1, V. Nguyen1, H. Nourkeyhani1, Y. Gao1,4, M. Wendel2, and B. Ganss1,*

1 Canadian Institutes for Health Research (CIHR) Group in Matrix Dynamics, University of Toronto, Faculty of Dentistry, 150 College Street, Toronto, ON M5S 3E2, Canada;
2 Center for Oral Biology (COB), Karolinska Institute, Huddinge, Sweden;

* corresponding author, b.ganss{at}utoronto.ca


   ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We aimed to analyze the differential gene expression in various murine dental tissues, expecting to find novel factors that are involved in tooth formation. We here describe the identification of a novel ameloblast-specific gene, amelotin (AMTN), by differential display polymerase chain-reaction (DD-PCR) analysis of microdissected ameloblasts, odontoblasts, dental pulp, and alveolar bone cells of 10-day-old mouse incisors. The conceptually translated protein sequence was unique and showed significant homology only with its human orthologue. The amelotin genes from mouse and human displayed a similar exon-intron structure and were expressed from loci on chromosomes 5 and 4, respectively, which have been associated with various forms of amelogenesis imperfecta. Expression of amelotin mRNA was restricted to maturation-stage ameloblasts in developing murine molars and incisors. Amelotin protein was efficiently secreted from transfected cells in culture. Taken together, our findings suggest that amelotin is a novel factor produced by ameloblasts that plays a critical role in the formation of dental enamel.

KEY WORDS: gene identification • amelotin • matrix maturation • differential gene expression • enamel


   INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The early morphogenesis of teeth as a prototypical epithelial appendage is regulated through a molecular network of reciprocal and iterative interactions between the oral epithelium and the underlying mesenchyme (Thesleff and Mikkola, 2002). The greater part of the mineralized components of teeth, namely, dentin and enamel, is formed by mesenchyme-derived odontoblasts and epithelium-derived ameloblasts, respectively. While the composition of dentin is somewhat similar to that of bone, mature enamel is unique in its formation, composition, hardness, and high degree of mineralization. Thus, it is capable of withstanding the lifelong challenges of the bacteria-laden, biomechanically active environment of the oral cavity.

The early differentiation of ameloblasts is regulated at a molecular level by the inductive action of bone morphogenetic protein (BMP) family members, particularly BMP4, and its antagonism by the activin A/follistatin pathway (Wang et al., 2004). Upon terminal differentiation, the cells elongate and begin to deposit specific proteins by an appositional growth mechanism, while retracting from the dentin-enamel junction. The three most prominent and well-investigated factors associated with matrix-mediated mineralization of enamel are amelogenins, representing > 90% of the organic enamel matrix component, and the non-amelogenin proteins enamelin and ameloblastin (Robinson et al., 1998). The self-assembly of amelogenin monomers into "nanospheres" has been shown to be critical for oriented crystal growth in enamel mineral (Gibson et al., 2001), and mice lacking ameloblastin display enamel hypoplasia, detachment of ameloblasts from the enamel matrix, and a de-regulation of ameloblast proliferation (Fukumoto et al., 2004). While the specific role of enamelin remains to be elucidated, mutations in all three enamel proteins have been associated with various forms of amelogenesis imperfecta (AI) in humans (MacDougall, 2003; Wright et al., 2003). The deposition and subsequent maturation of the enamel mineral are accompanied by a decreased synthesis and increased degradation of matrix proteins by stage-specific and complementary proteases, such as the matrix metalloproteinase enamelysin (MMP-20) and kallikrein-4 (Simmer and Hu, 2002). This co-ordinated degradation of the organic matrix is equally important for the formation of fully mineralized, functional dental enamel, since mice lacking enamelysin display an AI phenotype with poor enamel-to-dentin attachment (Caterina et al., 2002; Bartlett et al., 2004), and mutations in KLK-4 can cause autosomal-recessive hypomaturation AI (Hart et al., 2004).

The existence of autosomal-dominant AI phenotypes without genetic linkage to any of these five most commonly cited AI candidate genes—namely, amelogenin, ameloblastin, enamelin, MMP-20, or KLK-4 (Hart et al., 2003)—suggests the existence of additional genes that are crucial for proper amelogenesis. In this study, we report the identification and initial characterization of amelotin, a novel gene that appears to be specifically expressed in maturation-stage ameloblasts.


   MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
All procedures were performed in accordance with an approved animal protocol issued by the Division of Comparative Medicine, University of Toronto.

Identification of Amelotin by Differential Display PCR
Frozen frontal sections (8 µm thick) from randomly selected regions of 10-day-old mouse incisors that had been decalcified in 12.5% EDTA, pH 7.5, for 10 days at room temperature were stained with the use of an LCM Staining Kit (Ambion Inc., Austin, TX, USA), and subjected to Laser Capture Microdissection (LCM) of ameloblasts, odontoblasts, pulp cells, and osteoblasts, with a PixCell II system (Arcturus Bioscience Inc., Mountain View, CA, USA), according to the manufacturers’ recommendations. RNA was extracted from ~ 60 pooled samples that contained approximately 30 µg tissue per cell type, with the RNAqueous Micro kit, and reverse-transcribed with the message Amp II kit (both from Ambion) according to the manufacturer’s protocol. Differential display PCR analysis was performed with the primers A (TAGCCTCCCA) and B (TTTTTTTTVN) as previously described (Jheon et al., 2001). Bands of interest were excised, amplified, and sequenced.

Sequence Comparisons and Bioinformatics Analyses
We performed sequence similarity searches using the nucleotide-nucleotide and protein-protein BLAST programs blastn and blastp, respectively (NCBI; http://www.ncbi.nlm.nih.gov/BLAST/). Conceptually translated protein sequences were compared by ClustalW software (http://www.ebi.ac.uk/clustalw/). Other predictions for protein molecular weight, pI values, hydrophobicity, and motif searches were conducted with the ExPASy (Expert Protein Analysis System) proteomics server of the Swiss Institute of Bioinformatics (http://www.expasy.org/). We used the EnsEMBL genome resource database (www.ensembl.org) to identify the predicted genomic organization and locations of both murine and human genes.

Northern Blot Analysis
Total RNA from whole, freshly dissected, lower incisors of 10-day-old mice was isolated and converted into cDNA as previously described (Ganss and Kobayashi, 2002). The full-length coding sequence of amelotin was amplified from this cDNA template by PCR with primers 1 (GCACCGAGTAAAGTGGAGAAGT) and 2 (CACATTTTCCAGGTCTGTCTGA) and inserted into the TOPO-TA vector (Invitrogen, Burlington, ON, Canada). Inserts were excised by restriction digest, isolated, labeled with 32P-dCTP by random priming, and hybridized to multiple-tissue Northern blots from embryonic and adult mouse tissues (BD Biosciences, Mississauga, ON, Canada) and a separate membrane containing 15 µg RNA from 10-day-old mouse incisors as described (Teo et al., 2003).

In situ Hybridization
Whole-head tissues from CD-1 mice at different ages were decalcified, and paraffin sections were prepared as described (Somogyi et al., 2003). Digoxygenin-labeled amelotin sense and antisense cRNA probes were synthesized from the plasmid containing the full-length amelotin sequence, and in situ hybridizations on sections that included molars and incisors were performed as described previously (Gao et al., 2004).

Fluorescence Microscopy and Western Blotting
The full-length amelotin cDNA sequence was cloned in frame with three copies of a C-terminal FLAG tag (Barrios-Rodiles et al., 2005), and transfected into C2C12 cells with the use of LipofectAmine Plus (Invitrogen, Burlington, ON, Canada), according to the manufacturer’s instructions, in six-well culture plates for Western blots or 12-well chamberslides for fluorescence microscopy (both from BD Biosciences, Mississauga, ON, Canada). Cells were treated with 0.1% DMSO as vehicle alone or 10 µg/mL brefeldin A (Sigma Cat. #B6542, Oakville, ON, Canada), processed after 48 hrs for DAPI staining (Jheon et al., 2001) or immunohistochemistry with an anti-FLAG-Cy3 antibody, as recommended by the supplier (Sigma Cat. #A9594, Oakville, ON, Canada), and images superimposed. For Western analyses, cell lysates were prepared and processed for chemiluminescent detection as described (Arora et al., 2001).


   RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The amplification of cDNA fragments from various microdissected cell types of the dental organ from 10-day-old mouse lower incisors by differential display resulted in one prominent band of approx. 250 bp that appeared to be present in ameloblasts only (Fig. 1AGo, arrowheads). Sequencing of this band and search for sequence similarities (BLAST search, NCBI) revealed its identity as part of clone 5430427O21Rik (Kawai et al., 2001; Okazaki et al., 2002), a cDNA sequence coding for a predicted protein with hitherto unknown function. A BLAST search for similar protein sequences revealed only one protein sequence of significant homology, the human UNQ 689 protein (Clark et al., 2003). The murine cDNA (Fig. 1BGo) is 979 nucleotides long, coding for a 213-amino-acid protein with a predicted pI of 6.16 and a molecular mass of 22.1 kDa, while the presumptive, 209-amino-acid-containing human homologue has a predicted pI of 5.29 and a molecular weight of 21.6 kDa. The homology between murine and human sequences at the protein level (Fig. 1CGo) is 60%. Both sequences are predicted to contain high-frequency patterns, such as N-glycosylation, N-myristoylation, tyrosine sulphation, casein kinase II, and cAMP- and cGMP-dependent protein kinase phosphorylation motifs, and are likely phosphorylated at multiple serine and threonine residues (http://www.cbs.dtu.dk/services/NetPhos/). However, the only protein pattern that is conserved in both sequences is an N-terminal signal sequence. The protein from both species is particularly rich in proline, leucine, and threonine, and secondary structure predictions indicate a mostly irregular secondary structure, with the exception of a helical region in the central portion of the protein (http://cubic.bioc.columbia.edu/predictprotein/).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 1. Amelotin isolation and sequences. (A) Identification of an ameloblasts-specific gene fragment by DD-PCR. Two independent preparations of cDNA from ameloblasts (1), odontoblasts (2), dental pulp cells (3), and alveolar osteoblasts (4) were resolved on a 6% polyacrylamide gel and visualized by radioautography. Arrowheads indicate the bands representing the amelotin fragment. (B) cDNA and conceptually translated protein sequence of amelotin. The fragment identified by DD-PCR is underlined. (C) Protein sequence comparison of mouse and human amelotin. Asterisks indicate identical, semicolons highly conserved, and periods similar amino acids. (D) Exon-intron structure and predicted localization of mouse and human amelotin genes. Open squares indicate exons containing non-coding sequences. The relative location of the ameloblastin (Ambn) and enamelin (Enam), as well as the SIBLING gene cluster (Dspp, Dmp1, BSP. MEPE, OPN), is also indicated.

 
According to genome resources (www.ensembl.org), the exon/intron organization of both human and murine genes is conserved (Fig. 1DGo), consisting of 9 exons and 8 introns. Both the murine gene on chromosome 5 and the human orthologue on the syntenic region of chromosome 4q13.3 are located immediately proximal of the ameloblastin and enamelin genes, and close to the dentin- and bone-related SIBLING gene family, dentin sialophosphoprotein (DSPP), dentin matrix protein (DMP) 1, bone sialoprotein (BSP), matrix extracellular phosphoglycoprotein (MEPE), and osteopontin (OPN).

Northern Blot analysis of 5430427O21Rik mRNA expression in whole embryos during murine embryonic development did not show any detectable levels (Fig. 2AGo). In multiple post-natal or adult murine tissues, a ~ 1.2-kb mRNA transcript was found exclusively in teeth (Fig. 2BGo). A detailed in situ hybridization analysis of mRNA expression in murine molars (Fig. 3AGo) and incisors (Fig. 3BGo) revealed that 5430427O21Rik is expressed only in maturation-stage ameloblasts during tooth development, while hybridization with a control sense cRNA probe did not show any signal (not shown). Based on this expression pattern, we have named this novel factor ‘amelotin’. Amelotin expression is closely linked to the presence of ameloblasts and is thus transient during the eruptive stage of mouse molars, between post-natal days 5 and 15 (Fig. 3AGo). In the continuously erupting incisor (Fig. 3BGo), amelotin expression is dramatically up-regulated with the transition from secretory to maturation-stage ameloblasts, characterized by a shortening of the ameloblast cell body and the appearance of a zone of detached ameloblasts (Reith, 1961). Its expression is maintained during the maturation stage and gradually declines toward the zone of reduced ameloblasts.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Northern blot analysis of amelotin expression in whole mouse embryos at various stages of embryonic development (A) and several post-natal and adult tissues (B), relative to ß-actin. Amelotin expression appears to be tooth-specific.

 


View larger version (82K):
[in this window]
[in a new window]
 
Figure 3. Analysis of amelotin expression by in situ hybridization. (A) Arrowheads indicate the amelotin signal in ameloblasts of the first (M1), second (M2), and third (M3) molar on post-natal days d5 to d15. Bar indicates 30 µm. (B) Amelotin expression during various stages of amelogenesis in the 10-day-old mouse incisor from the incisal end to the cervical loop. Magnified views (a-i) show details of the restricted expression in maturation-stage ameloblasts. Bar indicates 10 µm.

 
We next investigated if amelotin was in fact secreted from cultured cells. Mouse myogenic C2C12 cells were chosen due to their consistent transfection efficiency and the absence of endogenous amelotin mRNA expression, as determined by RT-PCR analysis (not shown). Cells transfected with a plasmid for the cytomegalovirus (CMV) promoter-driven expression of the FLAG peptide alone showed high levels of peptide in the cytosol, as revealed by fluorescence microscopy (Fig. 4Go; cFLAG-pCMV5). When the cells were transfected with the same vector expressing a C-terminally FLAG-tagged amelotin protein, the signal within the cytosol was drastically diminished, while significant amounts of fusion protein could be detected in the conditioned media (Fig. 4Go; cFLAG-Amelotin). When brefeldin, an inhibitor of protein secretion, was added, the fusion protein was largely retained within the cells. Thus, amelotin appears to be an effectively secreted component of the extracellular matrix.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 4. Analysis of amelotin secretion from C2C12 cells by immunocytochemistry and Western blot. Expression of the FLAG peptide alone (cFLAG-pCMV5) shows a strong signal in the cytoplasm; Western analyses of cell lysates (a) and conditioned media (b) show no signal, since the FLAG peptide is too small to be resolved by PAGE. Expression of the amelotin-FLAG fusion protein (cFLAG-Amelotin) shows a weak signal in the cytoplasm and a strong signal in the conditioned media, while the addition of Brefeldin A (cFLAG-Amelotin + Brefeldin A) causes retention of the amelotin fusion protein in the cytosol. Bar indicates 50µm.

 

   DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this report, we describe the identification and initial characterization of a novel ameloblast-specific protein, which we have named ‘amelotin’. Amelotin is efficiently secreted and contains multiple potential serine and threonine phosphorylation sites like other structural enamel proteins, such as amelogenin, ameloblastin, and enamelin. However, based on the results presented in Fig. 4Go, which show little difference in molecular weight between intracellular and secreted amelotin, it appears that this protein contains few, if any, post-translational modifications. In contrast, its specific expression pattern in the developing dental enamel is similar to that of secreted proteolytic gene products, particularly KLK-4, which is also predominantly expressed by maturation-stage ameloblasts. Since it appears unlikely that ameloblasts would secrete large amounts of protein into a highly proteolytic environment, unless the protein is itself a protease, amelotin may possibly be engaged in proteolytic processing of the enamel matrix at this stage. We therefore hypothesize that amelotin is involved primarily in the maturation of enamel and thus the formation of its unique biomechanical characteristics during tooth development. Further conjectures with respect to its function from sequence comparisons or secondary structure predictions remain speculative at this time, since the predicted amelotin protein sequence appears to be unique. Gene knock-out experiments are currently under way to determine its function more precisely. Although we have demonstrated that amelotin is secreted from cultured cells, the localization of the secreted protein or its fragments in vivo remains to be analyzed. We are currently developing appropriate reagents to conduct these immunohistochemical studies.

As a result of large-scale sequencing efforts of expressed genes and whole genomes, the sequence of amelotin orthologues is available from mice and humans (accession numbers ENSMUSG00000029282 and ENSG00000187689, respectively, in the EnsEMBL genome resource), but amelotin sequences from lower vertebrates have not been reported to date. The murine and human amelotin genes are located close to two prominent ameloblast genes, ameloblastin and enamelin, and the SIBLING gene family, which is involved in the formation and maintenance of other mineralized tissues, such as dentin and bone. Investigating the relationship between amelotin expression and the presence and function of teeth, or the conservation of this gene cluster in other species, would likely advance our understanding of the molecular evolution of teeth and other mineralized tissues. In humans, there is a strong association of the chromosomal locus 4q21 with various forms of amelogenesis imperfecta (Forsman et al., 1994; Karrman et al., 1996). Some forms of this largely developmental defect have not been associated with mutations in currently known ameloblast-specific genes, and we are presently investigating the occurrence and significance of amelotin mutations in such cases.


   ACKNOWLEDGMENTS
 
We thank Marja Kärki (Center for Oral Biology, Huddinge) for tissue preparations and Nona Arneson (Princess Margaret Hospital, Toronto) for help with the Laser Capture Microdissection system. These studies were funded by faculty start-up funds to B.G., by the Stockholm County Council, and by a stipend to K.I. from the Canadian Institutes of Health Research (CIHR) Strategic Training Program "Cell Signaling in Mucosal Inflammation and Pain".


   FOOTNOTES
 
3 present address, Tokyo Medical and Dental University, Faculty of Dentistry, Department of Periodontology, Bunkyo-ku, Tokyo, Japan; Back

4 present address, Department of Endodontics, Institute of Dentistry, Binzhou Medical College, Binzhou, Shandong, China; Back

AUTHORS’ NOTE: During revision of this manuscript, the presumptive orthologues of the amelotin gene from the rat (Rattus norvegicus), the dog (Canis familiaris), and cattle (Bos taurus) appeared in the EnsEMBL Genome Resource database, with the respective accession numbers ENSRNOG00000003776, ENSCAFG00000002895, and ENSBTAG00000002928.

Received July 25, 2005; Last revision September 16, 2005; Accepted September 29, 2005


   REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Arora PD, Silvestri L, Ganss B, Sodek J, McCulloch CA (2001). Mechanism of cyclosporin-induced inhibition of intracellular collagen degradation. J Biol Chem 276:14100–14109.[Abstract/Free Full Text]

Barrios-Rodiles M, Brown KR, Ozdamar B, Bose R, Liu Z, Donovan RS, et al. (2005). High-throughput mapping of a dynamic signaling network in mammalian cells. Science 307:1621–1625.[Abstract/Free Full Text]

Bartlett JD, Beniash E, Lee DH, Smith CE (2004). Decreased mineral content in MMP-20 null mouse enamel is prominent during the maturation stage. J Dent Res 83:909–913.[Abstract/Free Full Text]

Caterina JJ, Skobe Z, Shi J, Ding Y, Simmer JP, Birkedal-Hansen H, et al. (2002). Enamelysin (matrix metalloproteinase 20)-deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 277:49598–49604.[Abstract/Free Full Text]

Clark HF, Gurney AL, Abaya E, Baker K, Baldwin D, Brush J, et al. (2003). The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. Genome Res 13:2265–2270.[Abstract/Free Full Text]

Forsman K, Lind L, Backman B, Westermark E, Holmgren G (1994). Localization of a gene for autosomal dominant amelogenesis imperfecta (ADAI) to chromosome 4q. Hum Mol Genet 3:1621–1625.[Abstract/Free Full Text]

Fukumoto S, Kiba T, Hall B, Iehara N, Nakamura T, Longenecker G, et al. (2004). Ameloblastin is a cell adhesion molecule required for maintaining the differentiation state of ameloblasts. J Cell Biol 167:973–983.[Abstract/Free Full Text]

Ganss B, Kobayashi H (2002). The zinc finger transcription factor Zfp60 is a negative regulator of cartilage differentiation. J Bone Miner Res 17:2151–2160.[ISI][Medline]

Gao Y, Jheon A, Nourkeyhani H, Kobayashi H, Ganss B (2004). Molecular cloning, structure, expression, and chromosomal localization of the human Osterix (SP7) gene. Gene 341:101–110.[ISI][Medline]

Gibson CW, Yuan ZA, Hall B, Longenecker G, Chen E, Thyagarajan T, et al. (2001). Amelogenin-deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 276:31871–31875.[Abstract/Free Full Text]

Hart PS, Wright JT, Savage M, Kang G, Bensen JT, Gorry MC, et al. (2003). Exclusion of candidate genes in two families with autosomal dominant hypocalcified amelogenesis imperfecta. Eur J Oral Sci 111:326–331.[ISI][Medline]

Hart PS, Hart TC, Michalec MD, Ryu OH, Simmons D, Hong S, et al. (2004). Mutation in kallikrein 4 causes autosomal recessive hypomaturation amelogenesis imperfecta. J Med Genet 41:545–549.[Free Full Text]

Jheon AH, Ganss B, Cheifetz S, Sodek J (2001). Characterization of a novel KRAB/C2H2 zinc finger transcription factor involved in bone development. J Biol Chem 276:18282–18289.[Abstract/Free Full Text]

Karrman C, Backman B, Holmgren G, Forsman K (1996). Genetic heterogeneity of autosomal dominant amelogenesis imperfecta demonstrated by its exclusion from the AIH2 region on human chromosome 4q. Arch Oral Biol 41:893–900.[ISI][Medline]

Kawai J, Shinagawa A, Shibata K, Yoshino M, Itoh M, Ishii Y, et al. (2001). Functional annotation of a full-length mouse cDNA collection. Nature 409:685–690.[Medline]

MacDougall M (2003). Dental structural diseases mapping to human chromosome 4q21. Connect Tissue Res 44(Suppl 1):285–291.

Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S, et al. (2002). Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature 420:563–573.[Medline]

Reith EJ (1961). The ultrastructure of ameloblasts during matrix formation and the maturation of enamel. J Biophys Biochem Cytol 9:825–839.

Robinson C, Brookes SJ, Shore RC, Kirkham J (1998). The developing enamel matrix: nature and function. Eur J Oral Sci 106(Suppl 1):282–291.

Simmer JP, Hu JC (2002). Expression, structure, and function of enamel proteinases. Connect Tissue Res 43:441–449.[ISI][Medline]

Somogyi E, Petersson U, Hultenby K, Wendel M (2003). Calreticulin—an endoplasmic reticulum protein with calcium-binding activity is also found in the extracellular matrix. Matrix Biol 22:179–191.[ISI][Medline]

Teo W, Chen H, Poon T, Ganss B (2003). Developmental expression pattern and DNA-binding properties of the zinc finger transcription factor Krox-26. Connect Tissue Res 44(Suppl 1):161–166.

Thesleff I, Mikkola M (2002). The role of growth factors in tooth development. Int Rev Cytol 217:93–135.[ISI][Medline]

Wang XP, Suomalainen M, Jorgez CJ, Matzuk MM, Werner S, Thesleff I (2004). Follistatin regulates enamel patterning in mouse incisors by asymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev Cell 7:719–730.[ISI][Medline]

Wright JT, Hart PS, Aldred MJ, Seow K, Crawford PJ, Hong SP, et al. (2003). Relationship of phenotype and genotype in X-linked amelogenesis imperfecta. Connect Tissue Res 44(Suppl 1):72–78.




This article has been cited by other articles:


Home page
J. Dent. Res.Home page
K. Kawasaki and K.M. Weiss
SCPP Gene Evolution and the Dental Mineralization Continuum
J. Dent. Res., June 1, 2008; 87(6): 520 - 531.
[Abstract] [Full Text] [PDF]


Home page
J. Dent. Res.Home page
H.C. Margolis, E. Beniash, and C.E. Fowler
Role of Macromolecular Assembly of Enamel Matrix Proteins in Enamel Formation
J. Dent. Res., September 1, 2006; 85(9): 775 - 793.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Zhu, M. L. Paine, W. Luo, P. Bringas Jr., and M. L. Snead
Altering Biomineralization by Protein Design
J. Biol. Chem., July 28, 2006; 281(30): 21173 - 21182.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwasaki, K.
Right arrow Articles by Ganss, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwasaki, K.
Right arrow Articles by Ganss, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
IADR Journals Advances in Dental Research ®
Journal of Dental Research ® Critical Reviews (1990-2004)