JDR Woodhead Publishing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ohno, S.
Right arrow Articles by Knudson, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohno, S.
Right arrow Articles by Knudson, W.
J Dent Res 84(11):1005-1009, 2005
© 2005 International and American Associations for Dental Research

RESEARCH REPORT
Biological

Induction of MMP-3 by Hyaluronan Oligosaccharides in Temporomandibular Joint Chondrocytes

S. Ohno1,2, M. Ohno-Nakahara1,2, C.B. Knudson1, and W. Knudson1,*

1 Department of Biochemistry, Rush Medical College, Rush University Medical Center, 1653 W. Congress Parkway, Chicago, IL 60612, USA; and
2 Department of Orthodontics and Craniofacial Developmental Biology, Division of Cervico-Gnathostomatology, Hiroshima University Graduate School of Biomedical Sciences, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553, Japan;

* corresponding author, wknudson{at}rush.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Low-molecular-weight hyaluronan (LMW-HA) is often increased in osteoarthritic joints; however, its biological function in cartilage has not been clarified. We hypothesize that LMW-HA causes the catabolic activation of chondrocytes through its interaction with CD44. Cartilage explants and chondrocytes, derived from bovine temporomandibular joints (TMJ), were examined for matrix loss and the expression of matrix metalloproteinase-3 (MMP-3) following treatment with hyaluronan oligosaccharides (HAoligos). Hyaluronan and CD44 were uniformly distributed throughout the fibrous and cartilaginous zones of the TMJ condyle. Treatment of cartilage explants with HAoligos resulted in cartilage matrix loss with increased secreted caseinolytic activity. HAoligos treatment of TMJ chondrocytes resulted in enhanced MMP-3 expression, whereas wash-out of the HAoligos in the middle of the experimental period reduced this induction. These results suggest that HAoligos activate chondrocytes, resulting in a substantial enhancement of proteinase expression, and the removal of HAoligos by wash-out reverses this catabolic activation.

KEY WORDS: temporomandibular joint • chondrocytes • hyaluronan • hyaluronan oligosaccharides • matrix metalloproteinase-3.

Abbreviations: mRNA, messenger ribonucleic acid • hr, hour • min, minute • DNA, deoxyribonucleic acid • SDS, sodium dodecyl sulfate • PAGE, polyacrylamide gel electrophoresis • GAPDH, glyceraldehyde-3-phosphate dehydrogenase • IgG, immunoglobulin G • HA, hyaluronan • LMW-HA, low-molecular-weight hyaluronan • HMW-HA, high-molecular-weight hyaluronan • HAoligos, hyaluronan oligosaccharides • HA6, hyaluronan hexasaccharides • OA, osteoarthritis • TMJ, temporomandibular joint • MMP-3, metalloproteinase-3 • RT-PCR, reverse-transcriptase/polymerase chain-reaction • DMEM, Dulbecco’s modified Eagle’s medium • FBS, fetal bovine serum • DAPI, 4', 6-diamidino-2-phenylindole, dihydrochloride • CP, cycle number at the crossing point.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The temporomandibular joint (TMJ) is a load-bearing region that accommodates compressive, shearing, and tensile loads generated by jaw functions. TMJ condyle cartilage is similar to the articular cartilage of other synovial joints, except that condylar cartilage is composed largely of fibrocartilage, with a thick, multilayered zone of collagen on the surface (Bouvier and Zimny, 1987). The pathological features of TMJ-associated arthritis are similar to those observed in the knee, namely, an imbalance between synthesis and degradation of the extracellular matrix. Excess mechanical stress, heredity, gender, and aging are postulated causative factors for the onset of arthropathy (Peyron, 1988). However, degeneration products of the extracellular matrix may also induce catabolic states in chondrocytes and serve as continually generated enhancers of the pathological process.

Hyaluronan (HA), a major glycosaminoglycan in cartilage, becomes fragmented during osteoarthritis (OA) (Dahl et al., 1985), due to enzymes like hyaluronidase (Sugimoto et al., 2004) or reactive oxygen species (Moseley et al., 1995), and this decrease in HA size is thought to promote TMJ disorders, due to the loss of synovial fluid lubrication. Furthermore, low-molecular-weight hyaluronan (LMW-HA) has been shown to contribute to the activation of macrophages (Noble et al., 1996; Hodge-Dufour et al., 1997). However, the potential for a direct action of LMW-HA on chondrocytes has not been clarified.

CD44 is the principal receptor for HA. CD44 participates in the anchoring of proteoglycan-HA aggregates, HA endocytosis, and signal transduction. Signal transduction, initiated through HA-CD44, participates in the transcriptional activation of macrophages and stimulation of inflammation (Hodge-Dufour et al., 1997). Furthermore, CD44 is induced in human cartilage by inflammatory cytokines (Jiang et al., 2001) and is up-regulated in OA (Ostergaard et al., 1997). Therefore, CD44 appears to be a key participant in arthropathies.

Nonetheless, the functions of CD44 or LMW-HA in TMJ cartilage have not been well-established. This study was conducted to document CD44 and HA expression and localization in TMJ cartilage, and to clarify the effects of LMW-HA on cartilage matrix integrity. HA oligosaccharides (HAoligos) were used as a LMW-HA to determine their potential for catabolic activation of TMJ chondrocytes, as occurs in other cells. The effect of HAoligos on the expression of matrix metalloproteinase-3 (MMP-3), a major proteinase responsible for cartilage proteoglycan degradation in OA joints, was examined with chondrocytes derived from TMJ cartilage.


   MATERIALS & METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Preparation of Hyaluronan Oligosaccharides
HA from human umbilical cord (Sigma #H1876, Sigma Chemicals, St. Louis, MO, USA) was digested by testicular hyaluronidase (320 units/mg, HA type I-S; Sigma) for 16 hrs at 37°C in 0.1 M sodium acetate buffer containing 0.5 M NaCl, pH 5.0. These digestion conditions were selected to yield preparations with a predominant proportion of HA hexasaccharide (Knudson et al., 2000), the minimum size of HA for binding to CD44 (Teriete et al., 2004). After precipitation of heat-inactivated hyaluronidase in 80% ethanol, the HAoligos were blown dry and dissolved in phosphate-buffered saline (PBS).

Tissue Acquisition
Whole heads from 18-month-old steers were obtained from a local slaughterhouse. Articular condyle cartilage was removed from TMJ within 12 hrs of death. Full-thickness cartilage slices of ~ 25 mm2 were cultured in 16-mm-diameter wells with 1 mL Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 1% penicillin/streptomycin, minimum essential vitamins, L-glutamine (Medium-A; all from Gibco, Grand Island, NY, USA), and 10% fetal bovine serum (FBS; Summit Biotechnology, Ft. Collins, CO, USA). Following a two-day recovery-culturing period, the slices were switched to serum-free, fresh Medium-A in the presence or absence of HAoligos, and incubated for 4 days. The medium was changed every two days with or without HAoligos.

Histochemistry
After fixation in 4% paraformaldehyde, the cartilage tissue slices were embedded in Tissue-Tek (EMS, Ft. Washington, PA, USA) and frozen on dry ice. Cryostat sections (10 µm) were stained with safranin-O, and counterstained with fast green (Knudson et al., 2000). Other sections were incubated with either a 1:500 dilution of biotinylated-hyaluronan binding protein (B-HABP; Seikagaku USA, Ijamsville, MD, USA) for 1 hr, or with a 1:200 dilution of biotinylated CD44 monoclonal antibody (IM-7; BD Biosciences, San Diego, CA, USA) or with biotinylated-rat IgG (IgG 2b{kappa}; BD Biosciences) for 2 hrs. For antibody or B-HAPB staining, sections were pre-treated with 2 units of chondroitinase ABC (Sigma) in 20 mM Tris-HCl, pH 8.0, for 1.5 hrs at 37°C to facilitate penetration of the B-HABP and antibodies. B-HABP and IM-7 were detected with rhodamine-red-conjugated Streptavidin (Jackson Immuno-Research, West Grove, PA, USA). Sections were mounted with medium containing 4'6-diamidino-2-phenylindoledihydrochloride (DAPI, Vector Laboratories, Burlingame, CA, USA), and were visualized with an Eclipse E600 microscope (Nikon, Melville, NY, USA).

Cell Isolation and Culture
Full-thickness slices of TMJ cartilage were incubated with pronase (0.2%) for 1 hr, followed by 0.0125% collagenase for 16 hrs, to obtain chondrocytes (cells were derived primarily from heterogeneous fibrous cartilage). The primary chondrocytes were cultured as high-density monolayers (2 x 106 cells/22-mm-diameter dish) in Medium-A containing 10% FBS. On day 2 after samples were seeded, the FBS concentration was reduced gradually to 1% for 12 hrs, and then 0% for 12 hrs. The chondrocytes were then treated with 0–500 µg/mL HAoligos for 0–48 hrs. In some experiments, the cultures were washed excessively by Medium-A after a 12-hour treatment with HAoligos, and then incubated in fresh Medium-A with or without 500 µg/mL high-molecular-mass HA (HMW-HA) (Healon®; Pharmacia, North Peapack, NJ, USA).

Real-time Reverse-transcriptase/Polymerase Chain-reaction (RT-PCR)
Total RNA was isolated from the bovine TMJ chondrocytes cultures with Trizol® (Gibco), used according to the manufacturer’s instructions, and reverse-transcribed with Molony murine leukemia virus reverse transcriptase (GENE-Amp RNA-PCR kit, Perkin-Elmer, Brachburg, NJ, USA) in a PTC-100TM Programmable Thermal Cycler (MJ Research, Watertown, MA, USA).

For real-time RT-PCR, the PCR products were detected by SYBR® Green nucleic acid gel stain (Molecular Probes, Eugene, OR, USA). For each template, primer-specific amplification and quantification cycles were run as follows: GAPDH, 57°C and 74°C, respectively; and MMP-3, 60°C and 86°C. The quantification cycles were set below the individual melting peak of each PCR product. The following primer sequences used were: (GAPDH) forward, 5'GTCAACGGATTTGGTGTATTGGG3', and reverse, 5'TGCCATGGGT GGAATCATATTGG3'; (MMP-3) forward, 5'CTCACAGACCTGACTCGGTT3', and reverse, 5'CACGCCTGAAGGAAGAGATG3', all obtained from Integrated DNA Technologies (Coralville, IA, USA). Thermal cycling was performed in a Smart Cycler (Cepheid, Sunnyvale, CA, USA).

The efficiency (E) of the real-time RT-PCR was calculated according to the equation of Rasmussen et al.(2003): E = 10[–1/slope] for GAPDH and MMP-3. The slope was determined from a graph of x = ng cDNA input and y = cycle number at the crossing point (CP). The CP is the PCR cycle number at which the peak of the 2nd derivative curve is maximal. The fold increase was calculated as a relative ratio of MMP-3 (Target) to GAPDH, following the equation of Pfaffl (2001):


Casein Zymography
Ten-times-concentrated culture medium from TMJ explant and chondrocyte cultures was assayed for protease activity by casein zymography, following activation with 1 mM aminophenylmercuric acetate in 50 mM Tris-HCl, 5 mM CaCl2, 1 µM ZnCl2, 1% Triton-X-100, and 0.02% NaN3 (Fernandez-Resa et al., 1995). Samples (30 µL) were separated by 10% SDS-PAGE with 0.5 mg/mL casein (Sigma). After electrophoresis, we removed the SDS by washing the gel twice with 50 mM Tris-HCl (pH 7.5) containing 2.5% Triton X-100 for 30 min, and twice with 50 mM Tris-HCl containing 0.15 M NaCl, 10 mM CaCl2, 0.1% Triton X-100, and 0.02% NaN3 for 10 min. Staining was performed for 1 hr at room temperature with 0.5% Coomassie brilliant blue in 10% acetic acid, until clear bands over a dark background were observed.

Statistical Analysis
To evaluate the effects of HAoligos on the expression of MMP-3 mRNA, we performed analysis of variance (ANOVA) using the statistical programs in Statview (Abacus Concepts, Inc., Berkeley, CA, USA).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The Distribution of Hyaluronan and CD44 in TMJ Cartilage
HA was highly abundant in the fibrous zone, especially in

the superficial layer, where many fibroblasts were assembled tangentially to the articular surface (Figs. 1AGo, 1BGo). The HA was also distributed uniformly throughout the transitional zone, a zone of abundant cartilage extracellular matrix that includes mature as well as hypertrophic chondrocytes (Figs. 1DGo, 1EGo). In contrast, a weaker deposition of HA was detected in the middle proliferative zone, a zone of high cell density. Negative controls displayed only faint signals (Figs. 1CGo, 1FGo).



View larger version (113K):
[in this window]
[in a new window]
  		Figure 1. Distribution of HA in TMJ condyle cartilage. Cryostat sections of TMJ articular cartilage were incubated with B-HABP for the visualization of HA distribution (B,E) or BSA (control staining; C,F). Rhodamine-red fluorescence reveals HA deposition; nuclei are stained with DAPI. Panels A and D show brightfield views of sections depicted in panels B and E, respectively. SL, superficial layer; FZ, fibrous zone; PZ, proliferative zone; TZ, transitional zone; HZ, hypertrophic zone; bars, 70 µm.

 
Coincident with the distribution of HA, CD44 was also highly expressed in the superficial layer of the TMJ condyle, with more diffuse staining throughout the fibrous zone (Figs. 2AGo, 2CGo, 2GGo). Preferential expression of CD44 was also detected in transitional and hypertrophic chondrocyte zones (Figs. 2BGo, 2DGo, 2HGo), with coordinately less expression in the middle proliferative zone. Tissues incubated with isotype-control IgG did not elicit positive signals (Figs. 2EGo, 2FGo).



View larger version (85K):
[in this window]
[in a new window]
  		Figure 2. Expression of CD44 in TMJ condyle cartilage. Cryostat sections of TMJ articular cartilage were incubated with biotinylated anti-CD44 antibody (C,D,G,H) or biotinylated-rat IgG2b{kappa} (E,F), with rhodamine-red detection and DAPI nuclear stain. Panels A and B show brightfield views of sections depicted in panels C and D, respectively. Regions identified by the rectangles in C and D are shown at higher magnification in panels G and H. Bars = 70 µm in panels A-F and 20 µm in panels G and H.

 
Cartilage Matrix Loss by HAoligos Treatment
Safranin-O/fast-green staining of control tissue revealed a proteoglycan-rich matrix in the deeper cartilaginous zone, as indicated by the intense red color. Only faint red staining was observed in the middle zone. Four-day incubation of control tissues under serum-free conditions alone resulted in a small loss of cartilage matrix within the middle zone. Four-day treatment of tissues with 250 µg/mL HAoligos resulted in enhanced fragility in the surface fibrous zone and marked proteoglycan loss in the deeper cartilaginous zone (Fig. 3AGo). Increased caseinolytic activity was detected in the conditioned medium of HAoligos-treated samples, especially in the four-day cultures (Fig. 3BGo).



View larger version (105K):
[in this window]
[in a new window]
  		Figure 3. Effect of HAoligos on cartilage matrix loss in the TMJ condyle. (A) TMJ articular cartilages were incubated in serum-free medium without or with HAoligos for 4 days. Cryostat sections of articular cartilage were stained with Safranin-O/fast green. Magnified views (x4) of the surface layer are shown in the insets. Bars = 100 µm. (B) Caseinolytic activity in the conditioned medium from cartilage explants treated with (+) or without (–) HAoligos for 2 or 4 days was assessed by casein zymography; clear bands represent enzymatic degradation of Coomassie-blue-stainable casein substrate. FZ, fibrous zone; CZ, cartilaginous zone.

 
MMP-3 Induction by HAoligos in TMJ Chondrocytes
In bovine TMJ chondrocytes, the induction of MMP-3 mRNA by HAoligos became significant at a dose of 100 µg/mL and showed an ~ 8-fold increase over the control at a dose of 250 µg/mL (Fig. 4AGo). The induction of MMP-3 mRNA was significant at 12 hrs, and the level reached a maximum at 24 hrs (Fig. 4BGo). In the conditioned medium from cultures treated with HAoligos, caseinolytic activity was also enhanced in a dose- and time-dependent manner (Figs. 4CGo, 4DGo).



View larger version (24K):
[in this window]
[in a new window]
  		Figure 4. Effect of HAoligos on MMP-3 expression. TMJ chondrocytes exhibit dose-dependent (A) and time-course-dependent (B) effects of HAoligos on MMP-3 mRNA. Shown are calculated ratios of the treated samples (black bars) to untreated controls (white bars). Caseinolytic activity in the conditioned medium of TMJ chondrocytes treated for 24 hrs with increasing concentrations of HAoligos (C) or ± 250 µg/mL HAoligos for 12 or 24 hrs (D) was assessed by casein zymography. Panel E illustrates the reversibility of these HAoligos effects following wash-out of HAoligos or wash-out in the presence of HMW-HA. Real-time PCR was performed, and changes in MMP-3 mRNA expression are depicted as fold-increase ratios of treated samples to untreated controls. Data represent the mean ± SD of three experiments. *p < 0.05; **p < 0.01.

 
To examine whether HMW-HA has the potential to abrogate the induction of MMP-3 by HAoligos, we initiated an HAoligos wash-out in the middle of the experimental period. Wash-out of HAoligos alone elicited an ~ 32% decrease in the MMP-3 induction level, as compared with HAoligos-treated cultures with no wash-out (Fig. 4EGo). The additional application of HMW-HA in the middle of the experimental period resulted in an ~ 37% decrease in HAoligos-induced MMP-3 levels, but this difference was not statistically significant from wash-out alone.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study, we have demonstrated that HA is distributed in both fibrous and cartilaginous zones of the TMJ condyle. The HA receptor CD44 is also expressed in TMJ cartilage, coordinated with the distribution of HA. Therefore, HA-CD44 interactions likely play an important role in cartilage matrix homeostasis in the TMJ condyle. HAoligos were used as a surrogate for the LMW-HA oligosaccharides that are thought to be present in the synovial fluid of OA TMJ joints. We demonstrated here that HAoligos induce matrix loss in the cartilaginous zone of TMJ condyle—a loss that is coincident with enhanced caseinolytic activity in the conditioned medium. It remains to be determined whether this activity represents latent or active proteinase, or whether it is the enhancement of this activity alone that is responsible for the loss of proteoglycan within the cartilaginous zone. However, analysis of the data suggests that there is a substantial activation of catabolic genes within the TMJ condyle. TMJ chondrocytes treated with HAoligos also induced a stimulation in MMP-3 mRNA, coupled with increased caseinolytic activity. MMP-3 has been shown to cleave proteoglycans, and is considered one of several proteinases responsible for OA (Flannery et al., 1999).

In the present study, the induction of MMP-3 by HAoligos was reduced by the wash-out of HAoligos. This demonstrates that the HAoligos induction of catabolism is reversible and not cytotoxic. The addition of HMW-HA to the wash-out media resulted in only minimally enhanced reduction in MMP-3. However, previous studies demonstrated that chondrocytes have the potential to resynthesize a native pericellular matrix within 4 hrs (Knudson, 1993). Therefore, during the 12-hour wash-out without added HMW-HA, the synthesis of endogenous HA may have down-regulated the expression of MMP-3 mRNA. Our recent related studies demonstrated that HAoligos also activate HA synthase-2 gene expression within 12 hrs of exposure of articular cartilage to HAoligos (Knudson et al., 2000; Ohno et al., 2005). Thus, differences in the capacity to synthesize endogenous HA, or differences in anabolic responsiveness to HAoligos, may explain why HMW-HA is more effective in down-regulating the expression of MMPs in other systems (Spessotto et al., 2002; Julovi et al., 2004).

In conclusion, HA and CD44 were detected in TMJ condyle cartilage, and LMW-HA enhances cartilage matrix degradation through the activation of MMP-3. Furthermore, wash-out of HAoligos had a reversible effect on MMP-3 induction. These results suggest that intra-articular pumping manipulation, to promote the fluid phase removal of small LMW-HA species, might reduce the pathology of TMJ arthropathy.


   ACKNOWLEDGMENTS
 
This work was supported by NIH RO1-AR43384, RO1-AR39507, and P50-AR39239.

Received December 17, 2004; Last revision July 7, 2005; Accepted July 14, 2005


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bouvier M, Zimny ML (1987). Effects of mechanical loads on surface morphology of the condylar cartilage of the mandible in rats. Acta Anat (Basel) 129:293–300.[Medline]

Dahl LB, Dahl IM, Engstrom-Laurent A, Granath K (1985). Concentration and molecular weight of sodium hyaluronate in synovial fluid from patients with rheumatoid arthritis and other arthropathies. Ann Rheum Dis 44:817–822.[Abstract/Free Full Text]

Fernandez-Resa P, Mira E, Quesada AR (1995). Enhanced detection of casein zymography of matrix metalloproteinases. Anal Biochem 224:434–435.[Medline]

Flannery CR, Little CB, Caterson B, Hughes CE (1999). Effects of culture conditions and exposure to catabolic stimulators (IL-1 and retinoic acid) on the expression of matrix metalloproteinases (MMPs) and disintegrin metalloproteinases (ADAMs) by articular cartilage chondrocytes. Matrix Biol 18:225–237.[ISI][Medline]

Hodge-Dufour J, Noble PW, Horton MR, Bao C, Wysoka M, Burdick MD, et al. (1997). Induction of IL-12 and chemokines by hyaluronan requires adhesion-dependent priming of resident but not elicited macrophages. J Immunol 159:2492–2500.[Abstract/Free Full Text]

Jiang H, Knudson CB, Knudson W (2001). Antisense inhibition of CD44 tailless splice variant in human articular chondrocytes promotes hyaluronan internalization. Arthritis Rheum 44:2599–2610.[ISI][Medline]

Julovi SM, Yasuda T, Shimizu M, Hiramitsu T, Nakamura T (2004). Inhibition of interleukin-1beta-stimulated production of matrix metalloproteinases by hyaluronan via CD44 in human articular cartilage. Arthritis Rheum 50:516–525.[ISI][Medline]

Knudson CB (1993). Hyaluronan receptor-directed assembly of chondrocyte pericellular matrix. J Cell Biol 120:825–834.[Abstract/Free Full Text]

Knudson W, Casey B, Nishida Y, Eger W, Kuettner KE, Knudson CB (2000). Hyaluronan oligosaccharides perturb cartilage matrix homeostasis and induce chondrocytic chondrolysis. Arthritis Rheum 43:1165–1174.[ISI][Medline]

Moseley R, Waddington R, Evans P, Halliwell B, Embery G (1995). The chemical modification of glycosaminoglycan structure by oxygen-derived species in vitro. Biochim Biophys Acta 1244:245–252.[Medline]

Noble PW, McKee CM, Cowman M, Shin HS (1996). Hyaluronan fragments activate an NF-kappa B/I-kappa B alpha autoregulatory loop in murine macrophages. J Exp Med 183:2373–2378.[Abstract/Free Full Text]

Ohno S, Im HJ, Knudson CB, Knudson W (2005). Hyaluronan oligosaccharide-induced activation of transcription factors in bovine articular chondrocytes. Arthritis Rheum 52:800–809.[Medline]

Ostergaard K, Salter DM, Andersen CB, Petersen J, Bendtzen K (1997). CD44 expression is up-regulated in the deep zone of osteoarthritic cartilage from human femoral heads. Histopathology 31:451–459.[ISI][Medline]

Peyron JG (1988). Epidemiological aspects of osteoarthritis. Scand J Rheumatol Suppl 77:29–33.[Medline]

Pfaffl MW (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:2002–2007.

Rasmussen TB, Uttenthal A, de Stricker K, Belak S, Storgaard T (2003). Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of foot-and-mouth disease virus. Arch Virol 148:2005–2021.[ISI][Medline]

Spessotto P, Rossi FM, Degan M, Di Francia R, Perris R, Colombatti A, et al. (2002). Hyaluronan-CD44 interaction hampers migration of osteoclast-like cells by down-regulating MMP-9. J Cell Biol 158:1133–1144.[Abstract/Free Full Text]

Sugimoto K, Iizawa T, Harada H, Yamada K, Katsumata M, Takahashi M (2004). Cartilage degradation independent of MMP/aggrecanases. Osteoarthritis Cartilage 12:1006–1014.[ISI][Medline]

Teriete P, Banerji S, Noble M, Blundell CD, Wright AJ, Pickford AR, et al. (2004). Structure of the regulatory hyaluronan binding domain in the inflammatory leukocyte homing receptor CD44. Mol Cell 13:483–496.[ISI][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ohno, S.
Right arrow Articles by Knudson, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohno, S.
Right arrow Articles by Knudson, W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
IADR Journals Advances in Dental Research ®
Journal of Dental Research ® Critical Reviews (1990-2004)