JDR JDR Most Read Articles
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haraldsson, G.
Right arrow Articles by Könönen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haraldsson, G.
Right arrow Articles by Könönen, E.
J Dent Res 83(6): 500-504, 2004
© 2004 International and American Associations for Dental Research

RESEARCH REPORT
Biological

Clonal Persistence of Oral Fusobacterium nucleatum in Infancy

G. Haraldsson1,2,*, W.P. Holbrook2, and E. Könönen1,3

1 Anaerobe Reference Laboratory, National Public Health Institute (KTL), Helsinki, Finland;
2 Faculty of Odontology, University of Iceland, Vatnsmyrarvegur 16 IS 101 Reykjavik, Iceland; and
3 Faculty of Dentistry, Kuwait University, Kuwait;

* corresponding author, gah{at}hi.is


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Once established, early-colonizing bacterial species tend to persist in the mouth. To obtain detailed information on the population dynamics of early-colonizing oral anaerobes, we examined the clonal diversity and persistence of clones among oral Fusobacterium nucleatum populations during the first 2 yrs of life. Consecutive salivary samples from 12 infants, collected at 2, 6, 12, 18, and 24 mos of age, yielded a total of 546 F. nucleatum isolates for clonal typing with arbitrarily primed PCR (AP-PCR). Up to 7 AP-PCR types were simultaneously detected in each sample. In 11 out of the 12 infants examined, AP-PCR types persisted for up to 1 yr. Strain turnover rate was high during the first year of life, but then the occurrence of persistent clones increased. This study indicates a wide genetic diversity within the species and provides evidence for the increasing persistence of F. nucleatum clones in the oral cavity with age.

KEY WORDS: Fusobacterium nucleatum • clonal diversity • clonal persistence • infants • AP-PCR


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Once established, early-colonizing bacterial species tend to persist in the mouth (Könönen et al., 1999b, 2002; Sarkonen et al., 2000). The clonal diversity among the pioneering commensals, such as facultative Streptococcus mitis and Streptococcus sanguis, and anaerobic Prevotella melaninogenica, is high, with many clones inhabiting the oral cavity simultaneously (Könönen et al., 1994; Hohwy et al., 2001; Pan et al., 2001). At the clonal level, the colonization pattern is rather unstable, especially during childhood. For instance, no persisting clones of S. mitis biovar 1 were detected in two infants examined, despite the high number of isolates tested, while persistent clones were frequent findings in their parents (Hohwy et al., 2001). In a longitudinal study on P. melaninogenica (Könönen, et al., 1994), 11 ribotypes were detected among 11 isolates from nine infants (mean age, 6 mos). Approximately 3 yrs later, 39 ribotypes were found among 96 isolates, but only 1 clonal type had persisted between these sampling occasions.

To obtain more detailed information on the population dynamics of early-colonizing commensal anaerobes, we chose Fusobacterium nucleatum as a representative because of its steadily increasing frequency of detection in the oral cavity during the first years of life (Könönen et al., 1994, 1999b) and its crucial role in biofilm formation (Kolenbrander, 2000). On the one hand, it is assumed that this strictly anaerobic, Gram-negative species is capable of surviving in aerobic environments, because of its coaggregation with oxygen-consuming bacteria. On the other hand, its extensive coaggregation capability facilitates even more fastidious anaerobic species to colonize the oral cavity (Bradshaw et al., 1998; Diaz et al., 2002). After teeth erupt, the occurrence of F. nucleatum increases, probably due to a more suitable living environment created by gingival crevices, so that the species resides in all children at the age of 3 yrs (Könönen et al., 1994).

The aims of the present investigation were, first, to examine the genetic diversity among developing F. nucleatum populations in the oral cavity and, second, to determine the turnover rate of oral F. nucleatum clones during the first 2 yrs of life.


   MATERIALS & METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Description of the Study Subjects and Specimens
The present investigation included 12 infants who originated from a satellite subpopulation of the Finnish Otitis Media (FinOM) cohort study, where 50 healthy Caucasian infants, 2 mos old at baseline, were recruited to a prospective, longitudinal study on the development of the microflora in the upper respiratory tract and were followed for up to 2 yrs of age as described previously (Könönen et al., 1999b, 2002, 2003). At the time of study enrollment, parent(s) provided a written informed consent for all infants participating in the FinOM cohort study, and the Ethical Issues’ Committees of the National Public Health Institute, Tampere University Hospital, and Department of Social and Health Care of Tampere City, Finland, approved the study protocol.

One specific target of the satellite study was to collect a minimum of 5 potential F. nucleatum isolates per infant on each sampling occasion, if available, from their unstimulated salivary samples at 5 scheduled visits at 2, 6, and 12 (± 2 wks) mos, and at 18 and 24 (± 4 wks) mos of age for clonal analysis. The specimen collection and culture of saliva have previously been described in detail (Könönen et al., 1999b). The isolates were stored at –70°C in vials containing 20% sterilized skim milk until revived for further testing. Twelve infants who were positive for F. nucleatum on at least 3 subsequent samplings and had the highest number of simultaneous isolates per sampling were chosen for the present investigation by clonal typing.

F. nucleatum Isolates
Altogether, 546 clinical isolates identified as F. nucleatum—based on their anaerobic growth, cell morphology (spindle-shaped, Gram-negative rods), special-potency antimicrobial disk profiles (resistant to vancomycin, but sensitive to kanamycin and colistin), and positive indole but negative lipase reaction (Jousimies-Somer et al., 2002)—were available out of 45 samples (mean of 12.1 isolates/sample) positive for this species. F. nucleatum subsp. nucleatum ATCC 25586T, F. nucleatum subsp. polymorphum ATCC 10953T, F. nucleatum subsp. fusiforme NCTC 11326T, and F. nucleatum subsp. vincentii ATCC 49256T were used as reference strains.

AP-PCR Typing
Arbitrarily-primed PCR (AP-PCR) typing was based on the method by George et al.(1997) with a slight modification by Haraldsson et al.(2004). Briefly, the isolates were revived from frozen stocks and grown on Brucella blood (5% horse blood) agar plates in an anaerobic atmosphere (10% CO2, 10% H2, 80% N2) at 37°C for 3 to 7 days. A few colonies were collected from the plates, suspended in 600 µL of 5% Chelex 100® (BioRad Laboratories, Hercules, CA, USA), and boiled for 10 min. The suspension was then mixed briefly on a vortex mixer, centrifuged for 10 min, and a 5-µL aliquot of the supernatant was used for AP-PCR. Primers C1 (5'-3' GATGAGTTCGTGTCCGTACAACTGG) and D8635 (5'-3' GAGCGGCCAAAGGGAGCAGAC) were used for routine typing and C2 (5'-3' GGTTATCGAAATCAGCCACAGCGCC) and D11344 (5'-3' AGTGAATTCGCGGTGAGATGCCA) (George et al., 1997; Narongwanichgarn et al., 2001) (Amersham Biosciences, Piscataway, NJ, USA) when additional typing was needed. AP-PCR was performed in a 25-µL vol in a 500-µL puReTaqTMReady-To-Go-PCRTM tube (Amersham Biosciences), containing 5 µL of DNA suspension and 80 nM of one primer in a thermal cycler (Eppendorf, Hamburg, Germany). A negative control (without DNA) was included in each AP-PCR run. A five-minute initial denaturation at 94°C and annealing at 35°C for 5 min each were followed by 5 cycles of denaturation at 94°C for 3 min, annealing at 37°C for 3 min, and elongation at 72°C for 3 min. This was followed by 30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 3 min, and a final elongation phase of 72°C for 10 min. Amplified products were kept at 4°C until separated by 1.5% agarose/TBE electrophoresis, stained with ethidium bromide, and photographed digitally (AlphaImager, Alpha Innotech Co, San Leandro, CA, USA) in a UV light. A 100-bp ladder (Amersham Biosciences) served as a molecular weight marker.

Statistical Analysis
Statistical comparisons and evaluations were performed by a chi-square ({chi}2) test and by non-linear simple regression (curve-fitting).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
AP-PCR Typing
The AP-PCR patterns generally consisted of 2 to 5 major amplicons, but ranged up to 11 amplicons. The major amplicons and consistent minor bands of each isolate were visually inspected and compared with the amplification patterns of all other isolates from the same infant. When the isolates examined with the primers C1 and D8635 were found to be identical with one primer (usually C1), but dissimilar with the other, they were further investigated with use of the C2 and D11344 primers. In all those cases, the other primers also separated the isolates, which were regarded as belonging to distinct AP-PCR types.

The relationship between the total number of isolates from each sample examined and the number of AP-PCR types found among these isolates is represented in Fig. 1Go.



View larger version (10K):
[in this window]
[in a new window]
  		Figure 1. The relationship between the total number of F. nucleatum isolates examined and the number of AP-PCR types detected in each sample. The equation of the line is y = 0.488 + log x (Rsq = 0.244; p = 0.001), where x is the number of isolates examined.

 
Genetic Diversity of F. nucleatum
Each infant harbored from 5 to 14 (mean = 8.3) different AP-PCR types during the first 2 yrs of life (Table). On average, 3.1 (maximum, 7) AP-PCR types could be found in one sample. As an example, Fig. 2Go shows representatives of all 9 different AP-PCR types found in Infant C on the 3 sampling occasions, where, altogether, 36 F. nucleatum isolates were available for clonal typing.



View larger version (78K):
[in this window]
[in a new window]
  		Figure 2. Representatives of all AP-PCR types from Infant C. The upper part of the gel = primer C1, and the lower part of the gel = primer D8635. Lanes 1 and 18, 100-bp ladder; lanes 2–5, AP-PCR type 3; lane 6, AP-PCR type 5; lane 7, AP-PCR type 6; lane 8, AP-PCR type 2; lane 9, AP-PCR type 4; lane 10, AP-PCR type 7; lane 11, AP-PCR type 8; lanes 12–14, AP-PCR type 9; lanes 15–16, AP-PCR type 1; lane 17, negative control.

 
At each time, 1 (or 2) AP-PCR type was dominating the other types (Table). A single AP-PCR type accounted for >= 50% of the available isolates in 36 out of 45 samples (80%), and in the remaining 9 samples the dominant type represented at least one-third of the available isolates. An AP-PCR type was considered dominant if it accounted for more than one-third of the F. nucleatum isolates from each sample.

Persistence of F. nucleatum AP-PCR Types
In 11 of the 12 infants examined, 1 or more AP-PCR types were found to persist for up to 1 yr. In Infant F, all AP-PCR types were replaced in the subsequent samples (Fig. 3Go). Strain turnover was especially frequent during the first year of life (only 22% of AP-PCR types persisted), but the persistence of strains became more common during the second year of life (44% of AP-PCR types persisted), although the difference was not statistically significant ({chi}2 = 2.97; p = 0.085). The dominant AP-PCR types were not more likely to be found on the next sampling than the other types ({chi}2 = 0.33; p = 0.565), nor were the persistent AP-PCR types more likely to be dominating in the subsequent sample ({chi}2 = 0.24; p = 0.622). In Infants B and E, AP-PCR types re-appeared after being undetected in one sample (Fig. 3Go).



View larger version (11K):
[in this window]
[in a new window]
  		Figure 3. Clonal diversity of oral F. nucleatum populations in 12 infants during their first 2 yrs of life. Each line represents distinct AP-PCR types (n = the number of isolates examined at each sampling). The dominating AP-PCR types (representing more than one-third of the examined isolates) are marked in bold. Broken lines indicate the periods during when the later-redetected types were missing.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study, we demonstrated a wide genetic diversity within oral F. nucleatum populations intra-individually. Furthermore, many clonal types persisted in infants’ mouths for as long as 1 yr. The stability of AP-PCR types increased after the first year of life. AP-PCR typing is a simple, rapid, and reliable method for fingerprinting bacterial strains; however, its usage for F. nucleatum has thus far been limited (George et al., 1997; Avila-Campos et al., 1999; Moraes et al., 2002). We selected 4 out of 12 tested primers for AP-PCR typing of clinical F. nucleatum isolates, based on their discriminating AP-PCR patterns for different Fusobacterium strains (George et al., 1997; Narongwanichgarn et al., 2001). George et al.(1997) used pulsed-field gel electrophoresis to confirm their results revealed by AP-PCR typing with 2 primers (C1 and C2). To eliminate the need for further confirmation, we used 2 additional primers, both of which give greater resolving power than the C1 primer alone.

The number of isolates available for clonal analysis is an important factor for viewing the actual clonal diversity within a sample. In general, the clonal variation seems to be high among oral early-colonizing commensals. The relationship between the number of F. nucleatum isolates examined and the number of AP-PCR types found indicates that when fewer than 10 isolates are examined, the number of AP-PCR types in the sample may be underestimated, whereas 20–25 isolates are likely to reveal the actual number of AP-PCR types present in the sample. This is in line with findings on S. mitis biovar 1 genotypes (Hohwy et al., 2001), where the clonal diversity is reflected in antigenic polymorphism displayed on the bacterial surface (Hohwy and Kilian, 1995). Early-colonizing commensals with wide antigenic variety seem to elicit natural immunity that is considered to be a benefit to the host (Smith et al., 1998). The clonal heterogeneity and frequent turnover of clones among oral F. nucleatum populations intra-individually allow the species to escape the host immune response, which is targeted against pathogens, and persistently to colonize the oral cavity.

Analysis of our data on F. nucleatum revealed, in 11 out of 12 infants on subsequent sampling occasions, identical AP-PCR types, which could be stable for up to 1 yr. In contrast, no persistent genotypes of S. mitis biovar 1 could be detected in the two examined infants who, at the end of the 9- to 10-month follow-up period, were 19 and 15 months old (Hohwy et al., 2001). Although the emergence and disappearance of different genotypes could be due to mutations or genetic recombination, Hohwy et al.(2001) rejected that hypothesis in their recent study on S. mitis biovar 1. Similarly, the composition of F. nucleatum populations seems to be constantly changing; distinct AP-PCR types emerged and disappeared, and a high variability was seen in the proportions of persistent types throughout the sampling period. The dominating AP-PCR types were not more likely to be detected in the subsequent sampling than other types, nor were the persistent types more likely to be dominating in the next sample. Persistence of F. nucleatum AP-PCR types in saliva was occasional during the first year of life; however, persistent types became more frequent after 1 yr of age. Eruption of the primary dentition creates a new microbial habitat, the gingival crevice, which offers an optimal habitat for many anaerobic species colonizing the oral cavity. This improved living environment may explain the increased persistence of F. nucleatum clones with age. However, Suchett-Kaye et al.(1998) found no persisting ribotypes among 38 F. nucleatum isolates from eight adult dental students compared with 61 isolates collected 16 mos earlier.

F. nucleatum is a heterogeneous species, and numerous AP-PCR profiles and high heterogeneity of serovars and ribotypes have been found within individuals (George et al., 1997; Thurnheer et al., 1999). Although generally considered to belong to the commensal oral microbiota, F. nucleatum presents some properties which are regarded as virulence factors: It is capable of binding to epithelial cells and invading them (Han et al., 2000), and of agglutinating and lysing erythrocytes (Gaetti-Jardim and Avila-Campos, 1999). In addition, some strains among F. nucleatum populations are capable of producing ß-lactamases (Könönen et al., 1999a; Nyfors et al., 2003). Using AP-PCR and enterobacterial repetitive intergenic consensus PCR to type F. nucleatum from root canal infections in two patients, Moraes et al.(2002) found a single clone to be highly dominant in these infections, suggesting a difference in virulence for different clones of F. nucleatum. In children, F. nucleatum has been associated with infections in the head and neck area, especially in chronic otitis media (Brook et al., 2000). We did not investigate the virulence of F. nucleatum; however, some differences in the virulence potential between these clones may exist. F. nucleatum was the most common anaerobic finding in nasopharyngeal aspirates collected from these infants during acute otitis media (Könönen et al., 2003). Interestingly, the colonization of infants’ nasopharynges by anaerobes occurs exclusively during infection (Könönen et al., 2003), and then the colonizing strains seem to be of salivary origin (Haraldsson et al., 2004). The high intra-individual diversity among F. nucleatum populations found in the present study as well as in other studies (George et al., 1997; Thurnheer et al., 1999), in connection with infections caused by single clones, implies the pathogenic potential of the species to be of an opportunistic nature, with some clones potentially being more virulent than others.

This investigation demonstrated a wide genetic diversity and frequent presence of persistent clones within oral F. nucleatum populations during the first 2 yrs of life. How closely related the clonal types of F. nucleatum are in this chronologically and geographically homogeneous study population remains to be shown.


View this table:
[in this window]
[in a new window]
  		Table. Number of Isolates Tested and AP-PCR Types (in bold) Detected among Oral F. nucleatum Populations in 12 Infants (A-L) Examined 5X during their First 2 Yrs of Life, and the Percentage of the Dominating Clone in Each Sample
 

   ACKNOWLEDGMENTS
 
The authors thank Jorma Torppa and Erkki Komulainen for statistical help. This investigation was financially supported by The Icelandic Research Fund for Graduate Students and The Centre for International Mobility (CIMO). The paper is based in part on an abstract presented at the 81st General Session of the IADR, Göteborg, Sweden, June, 2003.

Received August 19, 2003; Last revision March 8, 2004; Accepted March 18, 2004


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Avila-Campos MJ, Sacchi CT, Whitney AM, Steigerwalt AG, Mayer LW (1999). Arbitrarily primed-polymerase chain reaction for identification and epidemiologic subtyping of oral isolates of Fusobacterium nucleatum. J Periodontol 70:1202–1208.[ISI][Medline]

Bradshaw DJ, Marsh PD, Watson GK, Allison C (1998). Role of Fusobacterium nucleatum and coaggregation in anaerobe survival in planktonic and biofilm oral microbial communities during aeration. Infect Immun 66:4729–4732.[Abstract/Free Full Text]

Brook I, Yocum P, Shah K (2000). Aerobic and anaerobic bacteriology of concurrent chronic otitis media with effusion and chronic sinusitis in children. Arch Otolaryngol Head Neck Surg 126:174–176.[Abstract/Free Full Text]

Diaz PI, Zilm PS, Rogers AH (2002). Fusobacterium nucleatum supports the growth of Porphyromonas gingivalis in oxygenated and carbon-dioxide-depleted environments. Microbiology 148:467–472.[Abstract/Free Full Text]

Gaetti-Jardim Junior E, Avila-Campos MJ (1999). Haemagglutination and haemolysis by oral Fusobacterium nucleatum. New Microbiol 22:63–67.[Medline]

George KS, Reynolds MA, Falkler WA Jr (1997). Arbitrarily primed polymerase chain reaction fingerprinting and clonal analysis of oral Fusobacterium nucleatum isolates. Oral Microbiol Immunol 12:219–226.[ISI][Medline]

Han YW, Shi W, Huang GT, Kinder Haake S, Park NH, Kuramitsu H, et al. (2000). Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and invades epithelial cells. Infect Immun 68:3140–3146.[Abstract/Free Full Text]

Haraldsson G, Holbrook WP, Könönen E (2004). Clonal similarity of salivary and nasopharyngeal Fusobacterium nucleatum in infants with acute otitis media experience. J Med Microbiol 53:161–165.[Abstract/Free Full Text]

Hohwy J, Kilian M (1995). Clonal diversity of the Streptococcus mitis biovar 1 population in the human oral cavity and pharynx. Oral Microbiol Immunol 10:19–25.[ISI][Medline]

Hohwy J, Reinholdt J, Kilian M (2001). Population dynamics of Streptococcus mitis in its natural habitat. Infect Immun 69:6055–6063.[Abstract/Free Full Text]

Jousimies-Somer H, Summanen P, Citron DM, Baron EJ, Wexler HM, Finegold SM (2002). Wadsworth-KTL anaerobic bacteriology manual. 6th ed. Los Angeles: Star Publishing Company.

Kolenbrander PE (2000). Oral microbial communities: biofilms, interactions, and genetic systems. Annu Rev Microbiol 54:413–437.[ISI][Medline]

Könönen E, Asikainen S, Saarela M, Karjalainen J, Jousimies-Somer H (1994). The oral Gram-negative anaerobic microflora in young children: longitudinal changes from edentulous to dentate mouth. Oral Microbiol Immunol 9:136–141.[ISI][Medline]

Könönen E, Kanervo A, Salminen K, Jousimies-Somer H (1999a). beta-lactamase production and antimicrobial susceptibility of oral heterogeneous Fusobacterium nucleatum populations in young children. Antimicrob Agents Chemother 43:1270–1273.[Abstract/Free Full Text]

Könönen E, Kanervo A, Takala A, Asikainen S, Jousimies-Somer H (1999b). Establishment of oral anaerobes during the first year of life. J Dent Res 78:1634–1639.[Abstract/Free Full Text]

Könönen E, Jousimies-Somer H, Bryk A, Kilpi T, Kilian M (2002). Establishment of streptococci in the upper respiratory tract: longitudinal changes in the mouth and nasopharynx up to 2 years of age. J Med Microbiol 51:723–730.[Abstract/Free Full Text]

Könönen E, Syrjänen R, Takala A, Jousimies-Somer H (2003). Nasopharyngeal carriage of anaerobes during health and acute otitis media by two years of age. Diagn Microbiol Infect Dis 46:167–172.[ISI][Medline]

Moraes SR, Siqueira JF Jr, Rocas IN, Ferreira MC, Domingues RM (2002). Clonality of Fusobacterium nucleatum in root canal infections. Oral Microbiol Immunol 17:394–396.[ISI][Medline]

Narongwanichgarn W, Kawaguchi E, Misawa N, Goto Y, Haga T, Shinjo T (2001). Differentiation of Fusobacterium necrophorum subspecies from bovine pathological lesions by RAPD-PCR. Vet Microbiol 82:383–388.[ISI][Medline]

Nyfors S, Könönen E, Syrjänen R, Komulainen E, Jousimies-Somer H (2003). Emergence of penicillin resistance among Fusobacterium nucleatum populations of commensal oral flora during early childhood. J Antimicrob Chemother 51:107–112.[Abstract/Free Full Text]

Pan YP, Li Y, Caufield PW (2001). Phenotypic and genotypic diversity of Streptococcus sanguis in infants. Oral Microbiol Immunol 16:235–242.[ISI][Medline]

Sarkonen N, Könönen E, Summanen P, Kanervo A, Takala A, Jousimies-Somer H (2000). Oral colonization with Actinomyces species in infants by two years of age. J Dent Res 79:864–867.[Abstract/Free Full Text]

Smith DJ, King WF, Gilbert JV, Taubman MA (1998). Structural integrity of infant salivary immunoglobulin A (IgA) in IgA1 protease-rich environments. Oral Microbiol Immunol 13:89–96.[ISI][Medline]

Suchett-Kaye G, Décoret D, Barsotti O (1998). Clonal analysis by ribotyping of Fusobacterium nucleatum isolates obtained from healthy young adults with optimal plaque control. J Periodontal Res 33:179–186.[ISI][Medline]

Thurnheer T, Guggenheim B, Gruica B, Gmür R (1999). Infinite serovar and ribotype heterogeneity among oral Fusobacterium nucleatum strains? Anaerobe 5:79–92.




This article has been cited by other articles:


Home page
 J. Dent. Res.Home page
N. Arif, E.C. Sheehy, T. Do, and D. Beighton
Diversity of Veillonella spp. from Sound and Carious Sites in Children
J. Dent. Res., March 1, 2008; 87(3): 278 - 282.
[Abstract] [Full Text] [PDF]

Home page
 J. Dent. Res.Home page
S. Ruhl, S.A. Rayment, G. Schmalz, K.-A. Hiller, and R.F. Troxler
Proteins in Whole Saliva during the First Year of Infancy
J. Dent. Res., January 1, 2005; 84(1): 29 - 34.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haraldsson, G.
Right arrow Articles by Könönen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haraldsson, G.
Right arrow Articles by Könönen, E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
IADR Journals Advances in Dental Research ®
Journal of Dental Research ® Critical Reviews (1990-2004)