| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RAPID COMMUNICATION |
1 School of Dentistry and Dental Research Institute, University of California-Los Angeles, 10833 Le Conte Ave., Rm. 73-017 CHS, Los Angeles, CA 90095;
2 School of Medicine, UCLA;
3 Jonsson Comprehensive Cancer Center, UCLA; and
4 Molecular Biology Institute, UCLA;
* corresponding author, dtww{at}ucla.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: saliva • RNA • microarray • diagnostics
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Human genetic alterations are detectable both intracellularly and extracellularly (Sidransky, 1997). Nucleic acids have been identified in most bodily fluids, including blood, urine, and cerebrospinal fluid, and have been successfully adopted for use as diagnostic biomarkers for diseases (Anker et al., 1999; Rieger-Christ et al., 2003; Wong et al., 2003). Recent, investigators have become interested in detecting nucleic acid markers in saliva. To date, most of the DNA or RNA in saliva was found to be of viral or bacterial origin (Mercer et al., 2001; Stamey et al., 2003). There are limited reports demonstrating tumor cell DNA heterogeneity in the saliva of oral cancer patients (Liao et al., 2000; El-Naggar et al., 2001). We have not found published evidence of human mRNA detectable in saliva. The potential presence of mRNA in saliva may expand the repertoire of diagnostic analytes for translational and clinical applications.
Our laboratory has been actively involved in the application of patient-based genome-wide technologies to identify molecular biomarkers from saliva. We applied a series of emerging technologies to detect diagnostic analytes in saliva. A recent study from this laboratory (St. John et al., 2004) has identified salivary human interleukin 8 mRNA and protein to be diagnostic of patients with oral cavity and pharyngeal cancer. Based on this finding, we hypothesized that there are constituent human mRNAs in saliva. The purpose of this study was to determine the transcriptome profiles in cell-free saliva obtained from normal subjects. High-density oligonucleotide microarrays were used for the global transcriptome profiling. The salivary transcriptome patterns were used to generate a reference database for salivary transcriptome diagnostics applications.
|
MATERIALS & METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
30 yrs, and no history of malignancy, immunodeficiency, autoimmune disorders, hepatitis, HIV infection, or smoking. The study population was composed of six males and four females, with an average age of 42 yrs (range from 32 to 55 yrs).
Saliva Collection and Processing
Unstimulated saliva samples were collected between 9 a.m. and 10 a.m. in accordance with published protocols (Navazesh, 1993). Subjects were asked to refrain from eating, drinking, smoking, or oral hygiene procedures for at least 1 hr prior to saliva collection. Saliva samples were centrifuged at 2600 x g for 15 min at 4°C. Saliva supernatant was separated from the cellular phase. RNase inhibitor (Superase-In, Ambion Inc., Austin, TX, USA) and protease inhibitor (Aprotinin, Sigma, St. Louis, MO, USA) were then added to the cell-free saliva supernatant.
RNA Isolation from Cell-free Saliva
RNA was isolated from the cell-free saliva supernatant according to the modified protocol from the manufacturer (QIAamp Viral RNA kit, Qiagen, Valencia, CA, USA). Saliva (560 µL), mixed well with AVL buffer (2240 µL), was incubated at room temperature for 10 min. Absolute ethanol (2240 µL) was added, and the solution passed through silica columns by centrifugation at 6000 x g for 1 min. The columns were then washed twice, centrifuged at 20,000 x g for 2 min, and eluted with 30 µL RNase-free water at 9000 x g for 2 min. Aliquots of RNA were treated with RNase-free DNase (DNase I-DNA-free, Ambion Inc., Austin, TX, USA) according to the manufacturer’s instructions. The quality of isolated RNA was examined by RT-PCR for three housekeeping gene transcripts: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin-ß (ACTB), and ribosomal protein S9 (RPS9). Primers were designed with the use of PRIMER3 software (http://www.genome.wi.mit.edu) and were synthesized commercially (Fisher Scientific, Tustin, CA, USA) as follows: 5' TCACCAGGGCTGCTTTTAACTC 3' and 5' ATGACAAGCTT CCCGTTCTCAG 3' for GAPDH; 5' AGGATGCAGAA GGAGATCACTG 3' and 5' ATACTCCTGC TTGCTGATCCAC 3' for ACTB; 5' GACCCTTCGAGAAA TCTCGTCTC 3' and 5' TCTCATCAAGCGTCAGCAGTTC 3' for RPS9. The quantity of RNA was estimated with the use of a Ribogreen® RNA Quantitation Kit (Molecular Probes, Eugene, OR, USA).
Target cRNA Preparation
Isolated RNA was subjected to linear amplification according to published methods from our laboratory (Ohyama et al., 2000). In brief, reverse transcription with T7-oligo-(dT)24 as the primer was performed to synthesize the first-strand cDNA. The first round of in vitro transcription (IVT) was carried out with T7 RNA polymerase (Ambion Inc., Austin, TX, USA). The BioArrayTM High Yield RNA Transcript Labeling System (Enzo Life Sciences, Farmingdale, NY, USA) was used for the second round IVT to biotinylate the cRNA product; the labeled cRNA was purified with the use of the GeneChip® Sample Cleanup Module (Affymetrix, Santa Clara, CA, USA). The quantity and quality of cRNA were determined by spectrophotometry and gel electrophoresis. Small aliquots from each of the isolation and amplification steps were used to assess the quality by RT-PCR. The quality of the fragmented cRNA (prepared as described by Kelly et al., 2002) was assessed by capillary electrophoresis with the 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).
HG-U133A Microarray Analysis
The Affymetrix Human Genome U133A Array, which contains 22,215 human gene cDNA probe sets representing ~ 19,000 genes (i.e., each gene may be represented by more than one probe set), was applied for gene expression profiling. The array data were normalized and analyzed by means of Microarray Suite (MAS) software (Affymetrix). A detection p-value was obtained for each probe set. Any probe set with p < 0.04 was assigned as "present", indicating that the matching gene transcript was reliably detected (Affymetrix, 2001). The total number of present probe sets on each array was obtained, and the percentage (P%) of present genes was calculated. Functional classification was performed on selected genes (present on all 10 arrays, p < 0.01) by means of the Gene Ontology Mining Tool (www.netaffx.com).
Quantitative Gene Expression Analysis by Q-PCR
Q-PCR was performed with use of an iCyclerTM thermal Cycler (Bio-Rad, Hercules, CA, USA). A 2-µL aliquot of the isolated salivary RNA (without amplification) was reverse-transcribed into cDNA by means of MuLV Reverse Transcriptase (Applied Biosystems, Foster City, CA, USA). The resulting cDNA (3 µL) was used for PCR amplification with iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). The primers were synthesized by Sigma-Genosys (Woodlands, TX, USA) as follows: 5' GTGCTGAATGTGGACTCAATCC 3' and 5' ACCCTAAGGCA GGCAGTTG 3' for interleukin 1-beta (IL1B); 5' CCTGCGAAGA GCGAAACCTG 3' and 5' TCAATACTGGACAGCACCCTCC 3' for stratifin (SFN); 5' AGCGTGCCTTTGTTCACTG 3' and 5' CACACCAACCTCCTCATAATCC 3' for tubulin-alpha, ubiquitous (K-ALPHA-1). All reactions were performed in triplicate, with conditions customized for the specific PCR products. The initial amount of cDNA of a particular template was extrapolated from a standard curve with the use of LightCycler software 3.0 (Bio-Rad, Hercules, CA, USA). The detailed procedure for quantification by standard curve has been previously described (Ginzinger, 2002).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). RT-PCR results demonstrated that all 10 saliva samples contained mRNAs that encode for housekeeping genes: GAPDH, ACTB, and RPS9. The mRNA of these genes could be preserved without significant degradation for more than 6 mos at -80°C (Fig. 1). After 2 rounds of T7 RNA linear amplification, the average yield of biotinylated cRNA was 42.2 ± 3.9 µg with A260/280 = 2.067 ± 0.082 (Table 1). The cRNA ranged from 200 bp to 4 kb before fragmentation and was concentrated to approximately 100 bp after fragmentation. The quality of cRNA probe was confirmed by capillary electrophoresis before the hybridizations. ACTB mRNA was detectable by PCR/RT-PCR on the original sample and products from each amplification step: first cDNA, first in vitro transcription (IVT), second cDNA, and second IVT (Fig. 2).
|
|
|
). The major functions of the 185 genes are related to cell growth/maintenance (119 genes), molecular binding (118 genes), and cellular structure composition (95 genes). We termed these "Normal Salivary Core Transcriptome (NSCT)".
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Distinct differences exist between saliva and other bodily fluids (e.g., blood), in that saliva naturally contains micro-organisms (Sakki and Knuuttila, 1996). In addition, some extraneous substances (e.g., food debris) make the composition of saliva more complex. Therefore, it is simpler and more accurate to use the fluid/supernatant phase of saliva, instead of whole saliva, as a medium for detecting biomarkers. In our study, the conditions for separating the pellet and saliva supernatant were optimized to avoid mechanical rupture of cellular elements which would contribute to the RNA detected in the fluidic cell-free phase (St. John et al., 2004). Our results demonstrate that it is feasible and efficient to use cell-free saliva for transcriptome analysis. While it is a novel finding that human mRNAs exist in cell-free saliva supernatant, nucleic acids have long been detected in other cell-free bodily fluids and subsequently used for disease diagnostics. For example, specific oncogene, tumor suppressor gene, and microsatellite alterations have been identified in patients’ serum (Anker et al., 2003). Moreover, tumor mRNAs have been isolated and amplified from serum of patients with different malignancies (Kopreski et al., 1999; Fleischhacker et al., 2001). It has been widely accepted that these genomic messengers, detected extracellularly, can serve as biomarkers for diseases (Sidransky, 1997).
To our knowledge, this is the first report where human mRNA in unstimulated saliva is globally profiled. Using microarray technology, we discovered that approximately 3000 different human mRNAs exist in cell-free saliva of each normal subject. The salivary transcriptome pattern in cell-free saliva from normal populations could potentially serve as a health-monitoring database. It should be noted that we now know the human genome composed of more than 30,000 genes (Venter et al., 2001), and the probe sets on the HG U133A microarray used in our study represent only ~ 19,000 human genes. Additional gene transcripts not detectable by the HG U133A microarray will likely exist in cell-free saliva. Therefore, it is reasonable to predict that more human mRNAs will be identified in saliva by other advanced methodologies. The identified gene transcripts in this study, particularly the Normal Salivary Core Transcriptome (NSCT) mRNAs, represent the common transcriptome of normal cell-free saliva. We hypothesize that a different, informative, and diagnostic transcriptome can be identified in saliva from patients with various disease conditions. Human salivary mRNA can be used as diagnostic biomarkers for oral and systemic diseases that may be manifested in the oral cavity.
The finding that human RNA can be isolated, amplified, and profiled from cell-free saliva is novel. This discovery advances the concept that saliva has the potential to be a key medium for detecting and monitoring human health and disease. Moreover, this study provides new insights into previously unnoticed biological processes, such as the release and clearance of RNA in saliva. The origin of human mRNA found in saliva remains an important biological question. We will further elucidate whether saliva-based mRNA assays have the needed specificity and sensitivity for reliable diagnostics. Our laboratory is currently enrolling patients with oral squamous cell carcinomas and will investigate the oral-cancer-specific mRNA in saliva as diagnostic markers. We predict that this innovative approach, salivary transcriptome diagnostics (STD), will provide new opportunities for early diagnostics of oral and systemic diseases.
|
ACKNOWLEDGMENTS |
|---|
Received October 22, 2003; Last revision December 24, 2003; Accepted January 21, 2004
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Anker P, Mulcahy H, Chen XQ, Stroun M (1999). Detection of circulating tumour DNA in the blood (plasma/serum) of cancer patients. Cancer Metastasis Rev 18:65–73.[ISI][Medline]
Anker P, Mulcahy H, Stroun M (2003). Circulating nucleic acids in plasma and serum as a noninvasive investigation for cancer: time for large-scale clinical studies? Int J Cancer 103:149–152.[ISI][Medline]
Bonassi S, Neri M, Puntoni R (2001). Validation of biomarkers as early predictors of disease. Mutat Res 480–481:349–358.
El-Naggar AK, Mao L, Staerkel G, Coombes MM, Tucker SL, Luna MA, et al. (2001). Genetic heterogeneity in saliva from patients with oral squamous carcinomas: implications in molecular diagnosis and screening. J Mol Diagn 3:164–170.
Fleischhacker M, Beinert T, Ermitsch M, Seferi D, Possinger K, Engelmann C, et al. (2001). Detection of amplifiable messenger RNA in the serum of patients with lung cancer. Ann NY Acad Sci 945:179–188.
Ginzinger D (2002). Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol 30:503–512.[ISI][Medline]
Kelly JJ, Chernov BK, Tovstanovsky I, Mirzabekov AD, Bavykin SG (2002). Radical-generating coordination complexes as tools for rapid and effective fragmentation and fluorescent labeling of nucleic acids for microchip hybridization. Anal Biochem 311:103–118.[ISI][Medline]
Kopreski MS, Benko FA, Kwak LW, Gocke CD (1999). Detection of tumor messenger RNA in the serum of patients with malignant melanoma. Clin Cancer Res 5:1961–1965.
Lawrence HP (2002). Salivary markers of systemic disease: noninvasive diagnosis of disease and monitoring of general health. J Can Dent Assoc 68:170–174.
Liao PH, Chang YC, Huang MF, Tai KW, Chou MY (2000). Mutation of p53 gene codon 63 in saliva as a molecular marker for oral squamous cell carcinomas. Oral Oncol 36:272–276.[ISI][Medline]
Mercer DK, Scott KP, Melville CM, Glover LA, Flint HJ (2001). Transformation of an oral bacterium via chromosomal integration of free DNA in the presence of human saliva. FEMS Microbiol Lett 200:163–167.[ISI][Medline]
Navazesh M (1993). Methods for collecting saliva. Ann NY Acad Sci 694:72–77.[ISI][Medline]
Ohyama H, Zhang X, Kohno Y, Alevizos I, Posner M, Wong DT, et al. (2000). Laser capture microdissection-generated target sample for high-density oligonucleotide array hybridization. Biotechniques 29:530–536.[ISI][Medline]
Pusch W, Flocco MT, Leung SM, Thiele H, Kostrzewa M (2003). Mass spectrometry-based clinical proteomics. Pharmacogenomics 4:463–476.[ISI][Medline]
Rehak NN, Cecco SA, Csako G (2000). Biochemical composition and electrolyte balance of "unstimulated" whole human saliva. Clin Chem Lab Med 38:335–343.[ISI][Medline]
Rieger-Christ KM, Mourtzinos A, Lee PJ, Zagha RM, Cain J, Silverman M, et al. (2003). Identification of fibroblast growth factor receptor 3 mutations in urine sediment DNA samples complements cytology in bladder tumor detection. Cancer 98:737–744.[ISI][Medline]
Sakki T, Knuuttila M (1996). Controlled study of the association of smoking with lactobacilli, mutans streptococci and yeasts in saliva. Eur J Oral Sci 104:619–622.[ISI][Medline]
Sidransky D (1997). Nucleic acid-based methods for the detection of cancer. Science 278:1054–1059.
Sidransky D (2002). Emerging molecular markers of cancer. Nat Rev Cancer 3:210–219.
St. John MAR, Li Y, Zhou XF, Denny P, Ho CM, Montemagno C, et al. (2004). IL-6 and IL-8: potential biomarkers for oral cavity and oropharyngeal SCCA. Arch Otolaryngol Head Neck Surg (in press).
Stamey FR, DeLeon-Carnes M, Patel MM, Pellett PE, Dollard SC (2003). Comparison of a microtiter plate system to Southern blot for detection of human herpesvirus 8 DNA amplified from blood and saliva. J Virol Methods 108:189–193.[ISI][Medline]
Streckfus CF, Bigler LR (2002). Saliva as a diagnostic fluid. Oral Dis 8:69–76.
Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, et al. (2001). The sequence of the human genome [published erratum appears in Science 292(5523):1838]. Science 291(5507):1304–1351.
Wong LJ, Lueth M, Li XN, Lau CC, Vogel H (2003). Detection of mitochondrial DNA mutations in the tumor and cerebrospinal fluid of medulloblastoma patients. Cancer Res 63:3866–3871.
Xiang CC, Chen M, Ma L, Phan QN, Inman JM, Kozhich OA, et al. (2003). A new strategy to amplify degraded RNA from small tissue samples for microarray studies. Nucleic Acids Res 31:e53(1–5).
This article has been cited by other articles:
|
|
 |
|
  Z. Hu, B. G. Zimmermann, H. Zhou, J. Wang, B. S. Henson, W. Yu, D. Elashoff, G. Krupp, and D. T. Wong Exon-Level Expression Profiling: A Comprehensive Transcriptome Analysis of Oral Fluids Clin. Chem., May 1, 2008; 54(5): 824 - 832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rani, M. Clynes, and L. O'Driscoll Detection of Amplifiable mRNA Extracellular to Insulin-Producing Cells: Potential for Predicting Beta Cell Mass and Function Clin. Chem., November 1, 2007; 53(11): 1936 - 1944. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. G ZIMMERMANN, N. J. PARK, and D. T WONG Genomic Targets in Saliva Ann. N.Y. Acad. Sci., March 1, 2007; 1098(1): 184 - 191. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Lapaire, D. W. Bianchi, I. Peter, B. O'Brien, H. Stroh, J. M. Cowan, U. Tantravahi, and K. L. Johnson Cell-Free Fetal DNA in Amniotic Fluid: Unique Fragmentation Signatures in Euploid and Aneuploid Fetuses Clin. Chem., March 1, 2007; 53(3): 405 - 411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. D. Spivack Clin. Cancer Res., February 15, 2007; 13(4): 1351 - 1351. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hu, Y. Li, J. Wang, Y. Xie, K. Tjon, L. Wolinsky, R.R.O. Loo, J.A. Loo, and D.T. Wong Human Saliva Proteome and Transcriptome. J. Dent. Res., December 1, 2006; 85(12): 1129 - 1133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Kumar, G. J. Hurteau, and S. D. Spivack Validity of Messenger RNA Expression Analyses of Human Saliva Clin. Cancer Res., September 1, 2006; 12(17): 5033 - 5039. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Park, Y. Li, T. Yu, B. M.N. Brinkman, and D. T. Wong Characterization of RNA in Saliva Clin. Chem., June 1, 2006; 52(6): 988 - 994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, D. Elashoff, M. Oh, U. Sinha, M. A.R. St John, X. Zhou, E. Abemayor, and D. T. Wong Serum Circulating Human mRNA Profiling and Its Utility for Oral Cancer Detection J. Clin. Oncol., April 10, 2006; 24(11): 1754 - 1760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. T. Wong Salivary diagnostics powered by nanotechnologies, proteomics and genomics J Am Dent Assoc, March 1, 2006; 137(3): 313 - 321. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, P. Denny, C.-M. Ho, C. Montemagno, W. Shi, F. Qi, B. Wu, L. Wolinsky, and D.T. Wong The Oral Fluid MEMS/NEMS Chip (OFMNC): Diagnostic & Translational Applications Adv. Dent. Res., June 1, 2005; 18(1): 3 - 5. [Full Text] [PDF]
|
|
|
|
|
|
L.M. Smoot, J.C. Smoot, H. Smidt, P.A. Noble, M. Konneke, Z.A. McMurry, and D.A. Stahl DNA Microarrays as Salivary Diagnostic Tools for Characterizing the Oral Cavity's Microbial Community Adv. Dent. Res., June 1, 2005; 18(1): 6 - 11. [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, M. A. R. St. John, X. Zhou, Y. Kim, U. Sinha, R. C. K. Jordan, D. Eisele, E. Abemayor, D. Elashoff, N.-H. Park, et al. Salivary Transcriptome Diagnostics for Oral Cancer Detection Clin. Cancer Res., December 15, 2004; 10(24): 8442 - 8450. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| IADR Journals | Advances in Dental Research ® |
| Journal of Dental Research ® | Critical Reviews (1990-2004) |
