| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RESEARCH REPORT |
1 Canadian Institutes for Health Research (CIHR) Group in Matrix Dynamics, University of Toronto, Faculty of Dentistry, Fitzgerald Building, Room 239, 150 College Street, Toronto, ON M5S 3E2, Canada; and
2 Tokyo Medical and Dental University, Department of Hard Tissue Engineering (Periodontology), Bunkyo-ku, Tokyo, Japan;
*corresponding author, b.ganss{at}utoronto.ca
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: tooth development • zinc finger • He-Zhao deficiency • transcription factor
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The largest class of transcription factors in the mammalian genome is the C2H2 zinc finger gene family, which is comprised of several hundred individual members (Bellefroid et al., 1989; Tupler et al., 2001). Zinc finger genes have been recognized as critical regulators of many fundamental biological processes (Matise and Joyner, 1999), but little is known about the role of zinc finger transcription factors in the regulation of gene expression during tooth development and the specification of individual tooth cell phenotypes. A random screening for genes expressed in apical dental pulp cells of rat incisors has previously identified the novel zinc finger gene fragment Y150 (Matsuki et al., 1995). The full-length Y150 was later named Krox-26 due to the presence of five Krüppel-like zinc finger repeats. We have shown that the murine Krox-26 orthologue is expressed predominantly in developing craniofacial skeletogenic and dental structures, particularly in secretory-stage ameloblasts (Ganss et al., 2002), providing further evidence that Krox-26 may be involved in the molecular regulation of tooth development and amelogenesis. The aim of the present study was to identify and characterize the Krox-26 orthologue in humans, to analyze its expression with a particular emphasis on developing dental tissues, and to determine its chromosome localization.
|
MATERIALS & METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Isolation of Human KROX-26
The RPCI-11 Bacterial Artificial Chromosome (BAC) Library (Osoegawa et al., 2001) was screened with a random primed, 32P-dCTP-labeled 2-kb mouse Krox-26 cDNA fragment at the Centre for Applied Genomics (Hospital for Sick Children, Toronto, ON). DNA from one positive clone (RP11-285G1) was isolated, digested with restriction endonucleases, and further analyzed by Southern blot hybridization with the same 2-kb mouse Krox-26 cDNA probe. Positive restriction fragments were agarose-gel-purified, treated with Klenow enzyme (Amersham-Pharmacia Biotech, Baie d’Urfé, QC, Canada), cloned into the SrfI site of pCR Script Amp SK (+) (Stratagene, La Jolla, CA, USA), and sequenced (DNA Sequencing Facility, Centre for Applied Genomics, Hospital for Sick Children, Toronto, ON, Canada).
Northern Blot Analysis
A 674-bp PCR product was amplified from 30 ng of RP11-285G1 BAC DNA as template with the primers HKROX-3'.1 (AGCTCAAATCTCATTCAGCACCAG) and HKROX-5'.1 (GCCTGCACTTTCACAAATGTATCC) with the use of Advantage 2 DNA polymerase (BD Biosciences Clontech, Palo Alto, CA, USA) under the following conditions: one denaturation step at 94°C for 5 min, then 35 cycles of denaturation for 30 sec at 94°C, annealing for 30 sec at 62°C, and extension at 72°C for 40 sec, followed by a final extension step at 72°C for 7 min. A 32P-dATP and 32P-dCTP double-labeled DNA antisense probe was prepared from 100 ng of this PCR product with the primer HKROX-5'.1 and Klenow enzyme. A human 12-lane multiple-tissue Northern Blot (Clontech) was hybridized with this probe (3 x 106 cpm/mL) in ExpressHyb hybridization buffer (Clontech), according to the manufacturer’s instructions, and washed with 0.1 x SSC/0.1%SDS at 65°C for 30 min. Signals were detected by autoradiography. The blot was stripped (0.5% SDS at 85°C for 30 min) and re-hybridized with a random-primed, 32P-dCTP-labeled human ß-actin probe (T7 QuickPrime kit, Amersham-Pharmacia Biotech, Piscataway, NJ, USA) for control of equal loading between lanes and determination of relative expression levels. We re-hybridized the blot once with the Krox-26 probe to confirm reproducibility of results.
In situ Hybridization
Preparation of tissue sections
Twelve-week-old human embryo tissues were fixed with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) at 4°C overnight, washed in PBS, dehydrated in ethanol, and embedded in paraffin. For in situ hybridizations, sections of 8-µm thickness were cut, mounted on SuperFrost/Plus microscopy slides (Fisher Scientific, Nepean, ON, Canada), air-dried at 45°C overnight, and stored at 4°C in a dry atmosphere.
Probe synthesis
The 674-bp KROX-26 PCR fragment, described under "Northern Blot Analysis", was cloned into the pCR2.1-TOPO vector (Invitrogen, Burlington, ON, Canada) according to the manufacturer’s instructions, and the orientation of the insert was determined by digestion with SacI. Plasmids containing cDNA fragments in either orientation were linearized with HindIII, and digoxigenin-UTP-labeled antisense or sense RNA probes were synthesized with T7 RNA polymerase and the DIG RNA Labeling Kit (Roche Diagnostics, Laval, QC, Canada) according to the manufacturer’s instructions.
Hybridization and signal detection
Tissue sections were deparaffinized in xylene and rehydrated through ethanol (100%, 95%, 70%) and PBS. They were then re-fixed for 10 min in 4% PFA in PBS, washed for 2 15 min in DEPC-treated PBS, and incubated for 45 min in 10 mM Sodium Citrate (pH 6.0) at 80°C. After equilibration in 100 mM triethanolamine at pH 8.0 (TEA) for 2 min at room temperature (RT), the sections were acetylated for 2 x 5 min in 0.25% acetic anhydride in TEA with stirring, washed in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0) for 2 min, and dehydrated through a graded series of ethanol (70%, 95%, 100%). Sections were pre-hybridized in hybridization mix (50% de-ionized formamide, 300 mM NaCl, 10 mM Tris-HCl pH 7.6, 5 mM EDTA, 10 mM NaH2PO4, 10% dextran sulphate, 100 mg/mL yeast tRNA, 1 x Denhardt’s solution) for 1 hr at 58°C. The heat-denatured, digoxigenin-labeled cRNA probe was added at a concentration of 1 µg/mL and then hybridized overnight at 58°C in a chamber containing 50% Formamide/2xSSC as humidifying agent. Sections were then rinsed in 2 x SSC at RT, washed three times for 30 min each at 65°C in 50% formamide/2 x SSC, followed by one 30-minute wash at 65°C in 50% formamide/1 x SSC. The remaining probe was detected immunologically with an anti-digoxigenin/alkaline-phosphatase (AP)-conjugated antibody (Fab fragments, 1:100 dilution) and Nitro blue tetrazolium chloride (NBT) and 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) as substrate, according to the manufacturer’s instructions (Roche Diagnostics).
Fluorescence in situ Hybridization (FISH)
Isolated BAC DNA from clone RP11-285G1 was biotinylated by nick translation and hybridized in situ to metaphase chromosomes prepared from normal human lymphocytes as described previously (Bray et al., 1991). Chromosomes were counterstained with propidium iodide and 4',6-diamidino-2-phenylindol-dihydrochloride (DAPI). After hybridization, the biotinylated probe was detected with avidin-fluorescein isothiocyanate (FITC). Images of metaphase chromosome preparations were captured digitally by a cooled CCD camera (SenSys 1401E, Photometrics Roper Scientific, Tucson, AZ, USA).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). A sequence comparison between this ORF and the murine Krox-26 coding sequence (672 bp) revealed a sequence identity of 81.5% at the nucleotide level. The length of the Krox-26 3'-UTR from translation stop codon to polyadenylation signal is similar between mouse (1429 bp) and human (1262 bp). The conceptually translated human protein contains five consecutive C2H2 (Kruppel-type) zinc finger repeats as the only recognizable functional domain, and has a calculated molecular weight of 25915.4 Daltons and a predicted isoelectric point of 10.06. A sequence comparison of human and mouse Krox-26 proteins (Fig. 2) revealed an overall sequence identity of 85.3%, with the highest degree of conservation (94.0%) within the zinc finger domain. The human KROX-26 nucleotide sequence has been submitted to GenBank and was assigned the accession number AY137767.
|
|
) and by Northern hybridization in adult tissues (Fig. 3B). While hybridization with a digoxigenin-labeled cRNA sense probe did not produce any signals (Fig. 3A: b, d, f, h, j, l), the most prominent signals with an antisense cRNA probe were found in specific areas of developing craniofacial structures in tissues from 12-week-old embryos, including dental epithelium of maxillary molar tooth organs at various stages of development (Fig. 3A, a, c, e; arrows), tongue epithelium (g), tongue muscle (i), and osteoblasts of craniofacial bone (k). No signal could be detected in any other tissues investigated at this developmental stage, such as skeletal muscle, cartilage, or long bones (not shown).
|
) revealed the existence of a single 2.4-kb mRNA transcript, which is most highly expressed, relative to ß-actin, in mesoderm-derived tissues such as skeletal muscle, heart, kidney, and liver. Intermediate expression levels were observed in spleen, thymus, and brain. Expression levels in endoderm-derived tissues such as intestine and colon were found to be relatively low.
Chromosomal Localization of KROX-26
The genomic locus of the KROX-26 gene was determined by FITC fluorescence in situ hybridization (FISH) on metaphase chromosome spreads (Fig. 4). The single hybridization signal on both alleles of chromosome 10 was fine-mapped to the long arm of the chromosome at 10q11.21 by DAPI banding.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Analysis of our data shows a high degree of similarity between the human and mouse Krox-26 proteins in this region (Fig. 2), which indicates that the different C-terminal sequence in HKR-T1 may be the result of a mutation or a PCR or sequencing artefact. We propose to use the original designation for this gene, ZNF22 (Bray et al., 1991), as the common name for the KROX-26/HKR-T1/ZNF22/KOX15 genes. In previous studies, a DNA "recognition code" for C2H2 zinc finger genes (Choo and Klug, 1997) has been developed. With this recognition code, the A-rich sequence 5'-AGAAGAAAAAAAAAA-3' has been predicted as the theoretical DNA binding site for Krox-26 (A. Klug, personal communication). In contrast, in our experiments, using a target detection assay protocol (Thiesen and Bach, 1990), we have determined the preferred DNA binding site cCAATG for recombinant mouse Krox-26 protein (Teo et al., 2003), suggesting that Krox-26 may be involved in the regulation of gene transcription through CCAAT-box sequences (Mantovani, 1999). Regardless of this discrepancy between theoretically predicted and experimentally determined binding sites, the high degree of sequence conservation between the zinc finger domains suggests that Krox-26 regulates a similar set of target genes in mice and humans. The identity of these target genes remains to be determined.
The sequence (ORF + 3'-UTR) between the KROX-26 translation initiation codon and the conserved polyadenylation signal is approximately 2 kb, and the single mRNA transcript detected by Northern blot is 2.4 kb. Therefore, the transcription initiation site can be expected to be located ca. 400 base pairs upstream of the translation initiation codon, unless the primary KROX-26 transcript contains an intron in this region. Patches of G/C-rich, usually methylation-free, DNA (CpG islands) occur frequently in the human genome and have been associated with active promoter regions (Cross and Bird, 1995). Such a G/C-rich region can be identified approximately 2 kb upstream of the KROX-26 translation initiation site. Several conserved binding sites for components of the basal transcriptional machinery and regulatory transcription factors are located upstream of the KROX-26 translation initiation codon, including several, in part inverted, TATA and CCAAT box sequences. Conserved and adjacent binding sites for the transcription factors Smad4 and FAST-1 were predicted (Quandt et al., 1995) approximately 350 bp upstream of the AUG start codon. Smad4 and FAST-1 interact to activate target gene expression (Inman and Hill, 2002) downstream of the TGF-ß/Bone Morphogenetic Protein (BMP)/activin signaling pathway, which is critical for tooth development (Heikinheimo et al., 1998). The possibility that these transcription factors are involved in the regulation of KROX-26 transcription during early tooth formation is currently under investigation.
At 12 wks of gestation, KROX-26 is expressed in the epithelium and striated muscle cells of the developing tongue, but not in skeletal muscle. Since tongue muscle differentiation is known to precede skeletal muscle differentiation (Shuler and Dalrymple, 2001), the differential expression of KROX-26 in these tissues may indicate its involvement in the regulation of myogenic gene expression. The prominent expression of KROX-26 in dental epithelium and osteoblasts, similar to that seen for its murine orthologue, indicates that this factor may be involved in the molecular regulation of gene expression in developing teeth and the craniofacial skeleton. We provide further support for the potential involvement of Krox-26 in tooth development by locating the KROX-26 gene close to the genetic locus for permanent tooth agenesis in humans (He-Zhao deficiency). He-Zhao deficiency was identified in a large Chinese kindred as a rare, hereditary developmental disorder (Wang et al., 2000), whose gene locus was mapped to chromosome 10q11.2 (Liu et al., 2001). This chromosomal region contains other potential candidate genes, including the Wnt antagonist Dickkopf-1 (Dkk-1; Fedi et al., 1999) and a cluster of other, poorly characterized zinc finger genes (Rousseau-Merck et al., 1992). The targeted overexpression of Dkk-1 in the skin of transgenic mice results in a pleiotropic phenotype, including a failure to develop teeth (Andl et al., 2002). However, while Dkk-1 mRNA is expressed in multiple tissues, it is absent in developing teeth during normal mouse development (Monaghan et al., 1999). In contrast, we have confirmed the expression of Krox-26 during tooth development in mice (Ganss et al., 2002) and humans (Fig. 3A).
Sequencing of the KROX-26 gene in individuals affected with He-Zhao deficiency is required either to substantiate the role of KROX-26 as a candidate gene for this disorder or to reduce the number of potential candidate genes. For functional studies on Krox-26 in tooth and craniofacial morphogenesis, it will be essential to identify upstream regulators and downstream targets and to develop and analyze transgenic mouse models for Krox-26. Our ongoing studies have identified two genetic loci for Krox-26 in mice, one of which likely contains a pseudogene (unpublished). The sequence information from the single human KROX-26 gene will facilitate the identification of the functional murine gene and the production of transgenic animals. The detailed understanding of the molecular regulation of tooth formation and ameloblast differentiation is a prerequisite for the development of molecular strategies for repair and regeneration of dental tissues.
|
ACKNOWLEDGMENTS |
|---|
Received March 26, 2003; Last revision June 23, 2003; Accepted September 4, 2003
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bellefroid EJ, Lecocq PJ, Benhida A, Poncelet DA, Belayew A, Martial JA (1989). The human genome contains hundreds of genes coding for finger proteins of the Kruppel type. DNA 8:377–387.[ISI][Medline]
Bray P, Lichter P, Thiesen HJ, Ward DC, Dawid IB (1991). Characterization and mapping of human genes encoding zinc finger proteins. Proc Natl Acad Sci USA 88:9563–9567.
Choo Y, Klug A (1997). Physical basis of a protein-DNA recognition code. Curr Opin Struct Biol 7:117–125.[ISI][Medline]
Cross SH, Bird AP (1995). CpG islands and genes. Curr Opin Genet Dev 5:309–314.[ISI][Medline]
Fedi P, Bafico A, Nieto Soria A, Burgess WH, Miki T, Bottaro DP, et al. (1999). Isolation and biochemical characterization of the human Dkk-1 homologue, a novel inhibitor of mammalian Wnt signaling. J Biol Chem 274:19465–19472.
Frazier-Bowers SA, Guo DC, Cavender A, Xue L, Evans B, King T, et al. (2002). A novel mutation in human PAX9 causes molar oligodontia. J Dent Res 81:129–133.
Ganss B, Teo W, Chen H, Poon T (2002). Krox-26 is a novel C2H2 zinc finger transcription factor expressed in developing dental and osteogenic tissues. Connect Tissue Res 43:161–166.[ISI][Medline]
Heikinheimo K, Bègue-Kirn C, Ritvos O, Tuuri T, Ruch JV (1998). Activin and bone morphogenetic protein (BMP) signalling during tooth development. Eur J Oral Sci 106(Suppl 1):167–173.
Inman GJ, Hill CS (2002). Stoichiometry of active smad-transcription factor complexes on DNA. J Biol Chem 277:51008–51016.
Jernvall J, Thesleff I (2000). Reiterative signaling and patterning during mammalian tooth morphogenesis. Mech Dev 92:19–29.[ISI][Medline]
Kollar EJ, Mina M (1991). Role of the early epithelium in the patterning of the teeth and Meckel’s cartilage. J Craniofac Genet Dev Biol 11:223–228.[ISI][Medline]
Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, et al. (2001). Initial sequencing and analysis of the human genome. Nature 409:860–921.[Medline]
Lee SK, Krebsbach P, Ganss B, Slavkin Y, Yamada Y (1997). Krox 26, a new Kruppel-like zinc finger protein, plays a critical role in tooth development. J Dent Res 76:365–365.
Liu W, Wang H, Zhao S, Zhao W, Bai S, Zhao Y, et al. (2001). The novel gene locus for agenesis of permanent teeth (He-Zhao deficiency) maps to chromosome 10q11.2. J Dent Res 80:1716–1720.
Mantovani R (1999). The molecular biology of the CCAAT-binding factor NF-Y. Gene 239:15–27.[ISI][Medline]
Matise MP, Joyner AL (1999). Gli genes in development and cancer. Oncogene 18:7852–7859.[ISI][Medline]
Matsuki Y, Nakashima M, Amizuka N, Warshawsky H, Goltzman D, Yamada KM, et al. (1995). A compilation of partial sequences of randomly selected cDNA clones from the rat incisor. J Dent Res 74:307–312.
McCollum MA, Sharpe PT (2001). Developmental genetics and early hominid craniodental evolution. Bioessays 23:481–493.[ISI][Medline]
Monaghan AP, Kioschis P, Wu W, Zuniga A, Bock D, Poustka A, et al. (1999). Dickkopf genes are co-ordinately expressed in mesodermal lineages. Mech Dev 87:45–56.[ISI][Medline]
Osoegawa K, Mammoser AG, Wu C, Frengen E, Zeng C, Catanese JJ, et al. (2001). A bacterial artificial chromosome library for sequencing the complete human genome. Genome Res 11:483–496.
Peters H, Balling R (1999). Teeth. Where and how to make them. Trends Genet 15:59–65.[ISI][Medline]
Peters H, Neubuser A, Kratochwil K, Balling R (1998). Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev 12:2735–2747.
Quandt K, Frech K, Karas H, Wingender E, Werner T (1995). MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878–4884.
Rousseau-Merck MF, Tunnacliffe A, Berger R, Ponder BA, Thiesen HJ (1992). A cluster of expressed zinc finger protein genes in the pericentromeric region of human chromosome 10. Genomics 13:845–848.[ISI][Medline]
Satokata I, Maas R (1994). Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat Genet 6:348–356.[ISI][Medline]
Shuler CF, Dalrymple KR (2001). Molecular regulation of tongue and craniofacial muscle differentiation. Crit Rev Oral Biol Med 12:3–17.[Abstract]
Teo W, Chen H, Poon T, Ganss B (2003). Developmental expression pattern and DNA-binding properties of the zinc finger transcription factor Krox-26. Connect Tissue Res 44:161–166.
Thiesen HJ, Bach C (1990). Target detection assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on SP1 protein. Nucleic Acids Res 18:3203–3209.
Tupler R, Perini G, Green MR (2001). Expressing the human genome. Nature 409:832–833.[Medline]
van Genderen C, Okamura RM, Farinas I, Quo RG, Parslow TG, Bruhn L, et al. (1994). Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1-deficient mice. Genes Dev 8:2691–2703.
Wang H, Zhao S, Zhao W, Feng G, Jiang S, Liu W, et al. (2000). Congenital absence of permanent teeth in a six-generation Chinese kindred. Am J Med Genet 90:193–198.[ISI][Medline]
Wu BY, Hanley EW, Turka LA, Nabel GJ (1992). Isolation of a cDNA clone encoding a zinc finger protein highly expressed in T-leukemia lines. Blood 80:2571–2576.
This article has been cited by other articles:
|
|
 |
|
  B. Ganss and A. Jheon ZINC FINGER TRANSCRIPTION FACTORS IN SKELETAL DEVELOPMENT Crit. Rev. Oral. Biol. Med., September 1, 2004; 15(5): 282 - 297. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| IADR Journals | Advances in Dental Research ® |
| Journal of Dental Research ® | Critical Reviews (1990-2004) |
