| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RESEARCH REPORT |
1 Institute of Dentistry, PO Box 5281, 90014 University of Oulu, Oulu, Finland;
2 Department of Cytokine Biology, Forsyth Institute, Boston, MA, USA;
3 Oulu University Hospital, Oulu, Finland;
4 Oral Pathology Unit and Biomedicum, University of Helsinki, Laboratory Diagnostics, Helsinki University Central Hospital (HUCH), Helsinki, Finland;
5 Harvard-Forsyth Department of Oral Biology & Department of Cytokine Biology, Forsyth Institute, Boston, MA, USA;
7 Department of Endodontics, Faculty of Dentistry, University of Toronto, ON, Canada;
*corresponding author, palosaar{at}csc.fi
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
KEY WORDS: MMP • TGF-ß • BMP-2 • odontoblasts • pulp tissue • activation
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Transforming growth factor-ß (TGF-ß) and bone morphogenetic proteins (BMPs) are among the growth factors detected in dentin (Bessho et al., 1991; Cassidy et al., 1997) and are known to regulate tissue repair in teeth (Lesot et al., 1994). In response to an external irritation, these growth factors (especially TGF-ß1) are thought to be liberated from the mineralized dentin and to activate odontoblast extracellular matrix secretion and reparative dentin formation (Sloan and Smith, 1999). However, TGF-ß1 does not affect type I collagen synthesis in mature human odontoblasts and pulp tissue (Palosaari et al., 2001). Instead, TGF-ß1 differentially regulates MMP expression in cells of the mature human dentin-pulp complex (Tjäderhane et al., 1998; Palosaari et al., 2000).
Here we show that MT1-MMP is expressed in mature human odontoblasts and pulp tissue and that the expression is regulated by TGF-ß1 and BMP-2. We also demonstrate that, in addition to activating proMMP-2, MT1-MMP also converts proMMP-20 synthesized by the dentin-pulp complex cells into a form corresponding to active MMP-20.
|
MATERIALS & METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Cells and Culture Conditions
The collection of the native (uncultured, n = 3) odontoblasts and pulp tissue, with the use of Trizol® Reagent solution (Gibco BRL, Roskilde, Denmark) for total RNA extraction from the odontoblasts and pulp tissue separately, has been described previously in detail (Palosaari et al., 2000). In addition, native odontoblasts (n = 6) and pulp tissue (n = 3) were suspended into a 1x Laemmli buffer for MT1-MMP analysis by Western blot.
The procedures for odontoblast and pulp tissue cultures have been previously described in detail (Tjäderhane et al., 1998). For analysis of the effects of TGF-ß1 and BMP-2 on MT1-MMP expression, odontoblasts and pulp tissue were cultured for 24 hrs in serum-free OPTI-MEM I culture medium with antibiotics (Gibco BRL, Life Technologies Inc., Grand Island, NY, USA) (Tjäderhane et al., 1998) with 1 ng/mL TGF-ß1, 100 ng/mL BMP-2, 1 ng/mL TGF-ß1 combined with 100 ng/mL BMP-2, or without any mediator (n = 18 in each group). Recombinant human TGF-ß1 (Sigma, St. Louis, MO, USA) and recombinant human BMP-2 (Genetics Institute, Cambridge, MA, USA) were reconstituted according to the manufacturer's directions. Total RNA for MT1-MMP mRNA analysis was isolated as described below to produce 6 independent samples. Conditioned culture medium, without mediators, was used for the MMP-20 and MMP-2 activation analysis as described below. In addition, odontoblasts and pulp tissues (n = 3) cultured without mediators were suspended into a 1x reduced Laemmli buffer for MT1-MMP protein analysis by Western blot.
RNA Isolation, cDNA Synthesis, and PCR Amplification
Total RNA was isolated by means of Trizol® Reagent isolation. Before cDNA synthesis, genomic DNA was digested with DNase enzyme (1 U/2.0 µg total RNA) for 15 min at 37°C. The first-strand cDNA was synthesized from 2.0 µg of total RNA with the use of 200 units of SuperscriptTM II RnaseH- Reverse Transcriptase (Gibco BRL, Roskilde, Denmark) and random hexamer primers.
MT1-MMP mRNA expression in mature human odontoblasts and pulp tissue was analyzed by PCR procedures. Specific primers for amplifying MT1-MMP were: sense 5' CTGGCTACAGCAATATGGC 3' and antisense 5' TCACGGATGTAGGCATAGG 3'. Nested MT1-MMP sense primer was 5' AGTCACTCTCAGCGGCCAT 3' and antisense 5' AACGCCTTGCGAATGGCCT 3' (Sato et al., 1994). 18S ribosomal RNA was used as a control for RNA integrity. Primers were: sense 5' GGTTGATCCTGCCAGTAGCATATGCTTG 3' and antisense 5' GCGAGCGACCAAAGGAACCATAACTGAT 3' (McCallum and Maden, 1985). PCR amplification of 1 µL of cDNA consisted of 40 cycles (25 for nested PCR or 20 for 18S ribosomal), including 30 sec at 95°C, 90 sec at 54°C for MT1-MMP/56°C for nested PCR/68°C for 18S ribosomal, and 90 sec at 72°C followed by a 10-minute extension at 72°C. The sizes of the PCR products were 395 bp for MT1-MMP, 267 bp for nested MT1-MMP, and 125 bp for 18S.
We verified the identity of amplified product by sequencing the PCR product directly with MT1-MMP sense primer, using a DNA Sequencing Kit (Applied Biosystems, Warrington, UK). The data were analyzed with the use of NCBI's BLAST search tool.
Ribonuclease Protection Assay (RPA)
The effect of TGF-ß1 or BMP-2 on the expression of MT1-MMP mRNA in cultured odontoblasts and pulp tissue was assessed by RPA according to RPA IIITM Ribonuclease Protection Assay Kit instructions (Ambion Inc., Austin, TX, USA). A 3-µg quantity of the odontoblast (n = 6) and a 5-µg quantity of pulp tissue (n = 6) total RNA, respectively, was hybridized with 8 x 104 cpm [
-32P]UTP-labeled MT1-MMP antisense RNA probe (nucleotides 218-638). The hybridized RNA and probe were treated with 1:100 dilution of RNase A/RNase T1 mixture for 30 min at 37°C, and the protected fragment was analyzed by a 5% denaturing PAGE gel.
The MT1-MMP bands and respective 28S ribosomal RNA, which allowed for the quantification of MT1-MMP mRNA in different samples, were visualized following exposure to the x-ray film. Bands were scanned with an image-processing and analyzing program (ScionImage PC, Scion Corporation, Frederick, MD, USA). We calculated relative amounts of MT1-MMP expression by dividing the MT1-MMP scanning unit value by the respective value of the 28S ribosomal RNA. Six samples were used to calculate the mean and standard error of the mean (SEM) for the odontoblast and pulp tissue cultures. One-way analysis of variance (ANOVA) with an LSD post hoc test was used for analysis of the statistical significance among the groups, with the SPSS 10 program (SPSS Inc., Chicago, IL, USA).
ECL-Western Blotting
We used Western blot analysis to assess the synthesis of MT1-MMP in native and cultured odontoblasts and pulp tissue. A 10-µL quantity of native and a 20-µL quantity of cultured samples were resolved by 12% SDS-PAGE and transferred onto a nitrocellulose filter (Hoefer Scientific Instruments, San Francisco, CA, USA). The filter was incubated with a polyclonal antibody against human MT1-MMP (0.9 µg/mL) (Chemicon International, Inc., Temecula, CA, USA), and immunoreactive bands were visualized by an ECL system (Amersham, Buckinghamshire, UK) according to the manufacturer's instructions. The pro-recombinant human soluble MT1-MMP (200 ng) (Lee et al., 2001) served as a control for MT1-MMP antibody specificity.
MMP-20 Activation by MT1-MMP and APMA
The conditioned culture media from 7 odontoblast cultures were pooled for the analysis. The odontoblast cells, collected from 3 intact native teeth, were suspended into 100 µL of 50 mM Tris-HCl, 0.2 M NaCl, 1 mM CaCl2, pH 7.8. These cells were used for study of the activation of secreted and intracellular MMP-20, respectively. Soluble pro- and catalytic domains of MT1-MMP and soluble proMT1-MMP (Invitek GmbH, Berlin, Germany) were activated with 2 µM tumor-associated trypsin-2 (TAT-2) for 30 min at RT. The reactions were terminated by the addition of 200 ng of tumor-associated trypsin inhibitor (TATI) (Sorsa et al., 1997). The odontoblast cell and medium samples were treated with or without soluble activated MT1-MMP catalytic domain (further referred to as MT1-MMP [A]) (100 ng), and soluble MT1-MMP catalytic and hemopexin domains (further referred to as MT1-MMP [B]) (100 ng) for 6 hrs and 24 hrs, and with 2.0 mM aminophenyl mercuric acetate (APMA) for 24 hrs, in a 20-µL volume at 37°C. APMA is a wide-spectrum MMP-activator and served as a control for MT1-MMP activation. MMP-20 processing was analyzed with 12% SDS-PAGE and Western blotting with polyclonal antibody specific for porcine recombinant MMP-20 (1 µg/mL) (Bartlett et al., 1996) or polyclonal anti-human MMP-20 hinge region (1 µg/mL) (Sigma, St. Louis, MO, USA).
Conversion of pro-recombinant human MMP-20 by MT1-MMP (A) was assessed as follows. The human enamelysin catalytic domain was point-mutated (a glutamic acid at position 235 was changed to an alanine [VAAHEFGHA to VAAHAFGHA]), so that catalytic activity would be eliminated. Point-mutated rhMMP-20 was collected from an E. coli expression system and was purified over a Ni column. The eluted pro-rhMMP-20 containing an N-terminal His-Tag was refolded by dialysis. The supernatant of refolded point-mutant rhMMP-20 was concentrated ten-fold by use of a microcon YM-10 (Amicon, Inc., Beverly, MA, USA), and 15 µL was incubated with 200 ng of MT1-MMP (A) at 37°C for 6 and 24 hrs, respectively. A 15-µL quantity of MMP-20 alone served as the control. The reaction was terminated by the addition of 15 µL of 2x reducing sample buffer; the solution was then heated at 100°C for 5 min. Conversion of pro-rhMMP-20 was assessed by 12% SDS-PAGE and Western blotting with the use of a monoclonal anti-human-MMP-20 antibody (Fuji Chemicals, Inc., Toyama, Japan).
Activation of proMMP-2 by APMA or MT1-MMP served as positive controls for the activation studies of proMMP-20. ProMMP-2 activation by odontoblasts and conditioned odontoblast media was assessed by zymography as described previously (Tjäderhane et al., 1998).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). The specificity of the product was confirmed by nested-PCR of the cDNA fragments (Fig. 1A, 267 bp), and by sequencing. The endogenous control 18S ribosomal RNA was amplified by RT-PCR to the expected size of 125 bp from all cells assayed (Fig. 1A).
|
). In the odontoblasts, BMP-2 significantly down-regulated MT1-MMP mRNA expression by 66% (Figs. 1B, 1C, p = 0.006), while with TGF-ß1, alone and in combination with BMP-2, only modest down-regulation was observed. In the pulp tissue, similar effects were observed, but the reduction was not statistically significant (ANOVA, p = 0.231) (Figs. 1B, 1D).
MT1-MMP Protein in Odontoblasts and Pulp Tissue
On Western blots, immunoreactive 65-kDa and 51-kDa bands, corresponding to latent and active forms of MT1-MMP, were detected (Figs. 2A, 2B). Also, smaller 45-, 42-, 35-, and 20-kDa forms were present, especially in the pulp tissue (Figs. 2A, 2B). The specificity of the antibody was confirmed by localization of pro-recombinant human MT1-MMP to the expected size of 62 kDa on a Western blot (Fig. 2B).
|
). The active MT1-MMP catalytic domain (MT1-MMP [A]) induced the 57-kDa MMP-20 conversion into the 46-kDa form after only 6 hrs of incubation (Fig. 3A). In the conditioned culture media, the 57-kDa MMP-20 conversion to the 46-kDa form was observed with APMA, and with MT1-MMP (A) after a treatment of only 6 hrs, with no further changes after 24 hrs (Fig. 3B). MT1-MMP containing the catalytic plus hemopexin domain (MT1-MMP [B]) converted the MMP-20 57-kDa species to the 46-kDa form after a six-hour treatment, with no additional conversion after 24 hrs in the odontoblasts (not shown). In the conditioned culture media, the level of conversion was negligible even after 24 hrs (not shown).
|
).
APMA activated proMMP-2 in the odontoblasts and conditioned odontoblast culture media, respectively (Figs. 3E, 3F). MT1-MMP (A) and (B) activated proMMP-2 present in the odontoblasts (Fig. 3E). Since MMP-2 was largely in active form in the conditioned odontoblast culture media (Fig. 3F), further proMMP-2 activation by MT1-MMP could not be observed in the conditioned culture media.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The molecular masses for pro- and active MT1-MMP have been calculated to be 62.7 kDa and 53.8 kDa, respectively (Sang and Douglas, 1996). By Western blot, we detected 65- and 51-kDa immunoreactive bands, which most likely represent MT1-MMP latent and active forms. In addition, truncated forms were observed, especially in the pulp tissue. MMP-2 activation by MT1-MMP is accompanied by processing of MT1-MMP to a 43- to 44-kDa form (Lohi et al., 1996; Lehti et al., 1998; Hernandez-Barrantes et al., 2000), and active MT1-MMP can be shortened to a 43-kDa inactive membrane form and to a soluble 20-kDa fragment (Lehti et al., 2000). The presence of these truncated MT1-MMP forms may reflect the final phase of the proMMP-2 activation reaction (Stanton et al, 1998; Overall et al., 2000).
As previously described for tumor cells (Sato et al., 1994), we demonstrate that MT1-MMP activates proMMP-2 from odontoblasts. This may occur through the formation of the MT1-MMP, TIMP-2, and proMMP-2 complex (Cao et al., 1998; Kinoshita et al., 1998). However, the soluble catalytic domain of MT1-MMP can activate proMMP-2 without TIMP-2 (Will et al., 1996). Thus, we used the soluble catalytic domain for our experiments. In addition to proMMP-2, we demonstrate for the first time that MT1-MMP converts proMMP-20 into a form corresponding to active MMP-20 in odontoblasts. This was confirmed by the respective conversion of pro-recombinant human MMP-20 by MT1-MMP. Conversion of proMMP-2 or proMMP-20 in conditioned culture media was reduced compared with conversion by the cells. This likely occurred because, in the media, the enzymes are already mostly in an active form. This further indicates that the odontoblast-derived proMMPs may be activated at the cell surface during secretion.
The marked conversion of the MMP-20 57-kDa form into the 46-kDa form after APMA treatment strongly suggests that the 57-kDa species represents human proMMP-20, and that the 46-kDa species is an active form. The 57- and 46-kDa molecular weights are in accordance with the calculated 54.4-kDa and 42.6-kDa latent and active forms for human MMP-20 (Llano et al., 1997). Human MMP-20 was originally cloned from odontoblasts (Llano et al., 1997), but this is the first time it has been identified at the protein level as an enzyme activated by MT1-MMP.
In conclusion, this study demonstrates the expression and synthesis of MT1-MMP in human odontoblasts and pulp tissue, and demonstrates a possible role for MT1-MMP in the activation of other odontoblast-derived MMPs. Furthermore, TGF-ß1 and BMP-2 were demonstrated to regulate MT1-MMP expression differentially in the dentin-pulp complex, which may indirectly affect the activity of other odontoblast-derived MMPs. Therefore, MT1-MMP may have a special regulatory role in the dentin biomineralization process by virtue of its ability to activate proMMPs.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Received June 11, 2001; Last revision March 18, 2002; Accepted March 18, 2002
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS & METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bessho K, Tanaka N, Matsumoto J, Tagawa T, Murata M (1991). Human dentin-matrix derived bone morphogenetic protein. J Dent Res 56:228–232.
Birkedal-Hansen H, Moore WG, Bodden MK, Windsor LJ, Birkedal-Hansen B, DeCarlo A, et al. (1993). Matrix metalloproteinases: a review. Crit Rev Oral Biol Med 4:197–250.
Buttner FH, Chubinskaya S, Margerie D, Huch K, Flechtenmacher J, Cole AA, et al. (1997). Expression of membrane type 1 matrix metalloproteinase in human articular cartilage. Arthritis Rheum 40:704–709.[Medline]
Cao J, Drews M, Lee HM, Conner C, Bahou WF, Zucker S (1998). The propeptide domain of membrane type 1 matrix metalloproteinase is required for binding of tissue inhibitor of metalloproteinases and for activation of progelatinase A. J Biol Chem 273:34745–34752.
Caron C, Xue J, Bartlett JD (1998). Expression and localization of membrane type 1 matrix metalloproteinase in tooth tissues. Matrix Biol 17:501–511.[Medline]
Cassidy N, Fahey M, Prime SS, Smith AJ (1997). Comparative analysis of transforming growth factor-ß isoforms 1-3 in human and rabbit dentine matrices. Arch Oral Biol 42:219–223.[Medline]
Hernandez-Barrantes S, Toth M, Bernardo MM, Yurkova M, Gervasi DC, Raz Y, et al. (2000). Binding of active (57 kDa) membrane type 1-matrix metalloproteinase (MT1-MMP) to tissue inhibitor of metalloproteinase (TIMP)-2 regulates MT1-MMP processing and pro-MMP-2 activation. J Biol Chem 275:12080–12079.
Kinoshita T, Sato H, Okada A, Ohuchi E, Imai K, Okada Y, et al. (1998). TIMP-2 promotes activation of progelatinase A by membrane-type 1 matrix metalloproteinase immobilized on agarose beads. J Biol Chem 273:16098–16103.
Knäuper V, Will H, López-Otin C, Smith B, Atkinson SJ, Stanton H, et al. (1996). Cellular mechanisms for human procollagenase-3 (MMP-13) activation. J Biol Chem 271:17124–17131.
Lee HM, Golub LM, Cao J, Teronen O, Salo T, Zucker S, et al. (2001). CMT-3, a non-antimicrobial tetracycline, inhibits MT1-MMP activity: relevance to cancer. Curr Med Chem 8:257–260.[Medline]
Lehti K, Lohi J, Valtanen H, Keski-Oja J (1998). Proteolytic processing of membrane-type-1 matrix metalloproteinase is associated with gelatinase A activation at the cell surface. Biochem J 334(Pt 2):345–353.
Lehti K, Valtanen H, Wickström S, Lohi J, Keski-Oja J (2000). Regulation of membrane-type-1 matrix metalloproteinase activity by its cytoplasmic domain. J Biol Chem 275:15006–15013.
Lesot H, Smith AJ, Tziafas D, Bégue-Kirn C, Cassidy N, Ruch JV (1994). Biologically active molecules and dental tissue repair: a comparative review of reactionary and reparative dentinogenesis with the induction of odontoblast differentiation in vitro. Cells Mater 4:199–218.
Llano E, Pendás AM, Knäuper V, Sorsa T, Salo T, Salido E, et al. (1997). Identification and structural and functional characterization of human enamelysin (MMP-20). Biochemistry 36:15101–15108.[Medline]
Lohi J, Lehti K, Westermarck J, Kahari VM, Keski-Oja J (1996). Regulation of membrane-type matrix metalloproteinase-1 expression by growth factors and phorbol 12-myristate 13-acetate. Eur J Biochem 239:239–247.[Medline]
McCallum FS, Maden BE (1985). Human 18 S ribosomal RNA sequence inferred from DNA sequence. Variations in 18 S sequences and secondary modification patterns between vertebrates. Biochem J 232:725–733.[Medline]
Overall CM, Tam E, McQuibban GA, Morrison C, Wallon UM, Bigg HF, et al. (2000). Domain interactions in the gelatinase A.TIMP-2.MT1-MMP activation complex. The ectodomain of the 44-kDa form of membrane type-1 matrix metalloproteinase does not modulate gelatinase A activation. J Biol Chem 275:39497–39506.
Palosaari H, Wahlgren J, Larmas M, Rönkä T, Sorsa T, Salo T, et al. (2000). The expression of MMP-8 in odontoblasts and dental pulp cells is down-regulated by TGF-ß1. J Dent Res 79:77–84.
Palosaari H, Tasanen K, Risteli J, Larmas M, Salo T, Tjäderhane L (2001). Baseline expression and effect of TGF-ß1 on type I and III collagen mRNA and protein synthesis in human odontoblasts and pulp cells in vitro. Calcif Tissue Int 68:122–129.[Medline]
Sang DA, Douglas DA (1996). Computational sequence analysis of matrix metalloproteinases. J Protein Chem 15:137–160.[Medline]
Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, et al. (1994). A matrix metalloproteinase expressed on the surface of invasive tumour cells. Nature 370:61–65.[Medline]
Sato T, del Carmen Ovejero M, Hou P, Heegaard AM, Kumegawa M, Foged NT, et al. (1997). Identification of the membrane-type matrix metalloproteinase MT1-MMP in osteoclasts. J Cell Sci 110(Pt 5):589–596.[Abstract]
Sloan AJ, Smith AJ (1999). Stimulation of the dentin-pulp complex of rat incisor teeth by transforming growth factor-ß isoforms 1-3 in vitro. Arch Oral Biol 44:149–156.[Medline]
Sorsa T, Salo T, Koivunen E, Tyynelä J, Konttinen YT, Bergmann U, et al. (1997). Activation of type IV procollagenases by human tumor-associated trypsin-2. J Biol Chem 272:21067–21074.
Stanton H, Gavrilovic J, Atkinson S, d'Ortho M-P, Yamada KM, Luciano Z, et al. (1998). The activation of proMMP-2 (gelatinase A) by HT1080 fibrosarcoma cells is promoted by culture on a fibronectin substrate and is concomitant with an increase in processing of MT1-MMP (MMP-14) to a 45 kDa form. J Cell Sci 111:2789–2798.[Abstract]
Tjäderhane L, Salo T, Larjava H, Larmas M, Overall CM (1998). A novel organ culture method to study the function of human odontoblasts in vitro: gelatinase expression by odontoblasts is differentially regulated by TGF-ß1. J Dent Res 77:1486–1496.
Will H, Atkinson S, Butler GS, Smith B, Murphy G (1996). The soluble catalytic domain of membrane type 1 matrix metalloproteinase cleaves the propeptide of progelatinase A and initiates autoproteolytic activation. J Biol Chem 271:17119–17123.
This article has been cited by other articles:
|
|
 |
|
  A. Mazzoni, F. Mannello, F.R. Tay, G.A.M. Tonti, S. Papa, G. Mazzotti, R. Di Lenarda, D.H. Pashley, and L. Breschi Zymographic Analysis and Characterization of MMP-2 and -9 Forms in Human Sound Dentin J. Dent. Res., May 1, 2007; 86(5): 436 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.D. Bartlett Making the Cut in Dental Enamel--The Discovery of Enamelysin (MMP-20) J. Dent. Res., November 1, 2005; 84(11): 986 - 988. [Full Text] [PDF]
|
|
|
|
 |
|
 K. Bourd-Boittin, D. Septier, R. Hall, M. Goldberg, and S. Menashi Immunolocalization of Enamelysin (Matrix Metalloproteinase-20) in the Forming Rat Incisor J. Histochem. Cytochem., April 1, 2004; 52(4): 437 - 445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Larmas Dental Caries Seen from the Pulpal Side: a Non-traditional Approach J. Dent. Res., April 1, 2003; 82(4): 253 - 256. [Full Text] [PDF]
|
|
|
|
|
|
M. Sulkala, M. Larmas, T. Sorsa, T. Salo, and L. Tjaderhane The Localization of Matrix Metalloproteinase-20 (MMP-20, Enamelysin) in Mature Human Teeth J. Dent. Res., September 1, 2002; 81(9): 603 - 607. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| IADR Journals | Advances in Dental Research ® |
| Journal of Dental Research ® | Critical Reviews (1990-2004) |
