HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Figures Only Full Text (PDF) Services Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (17) Citing Articles via Google Scholar Google Scholar Articles by Nociti, F.H. Articles by Somerman, M.J. Search for Related Content PubMed PubMed Citation Articles by Nociti, F.H., Jr. Articles by Somerman, M.J.

Cementum: A Phosphate-sensitive Tissue

¹ Department of Periodontics/Prevention/Geriatrics, School of Dentistry, Rm. 3310M Dental, University of Michigan, 1011 N. University Avenue, Ann Arbor, MI 48109-1078, USA;
² Department of Prosthodontics/Periodontics, Division of Periodontics, School of Dentistry at Piracicaba, University of Campinas, Brazil;
³ Department of Oral Pathology, Faculty of Dentistry, Hiroshima University, Japan;
⁴ Department of Developmental Biology and Howard Hughes Medical Institute, School of Medicine, Stanford University, CA, USA;
⁵ Department of Periodontics, School of Dentistry, University of Washington, Seattle, USA;

*corresponding author, nociti{at}umich.edu

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Ectopic calcification within joints has been reported in humans and rodents exhibiting mutations in genes that regulate the level of extracellular pyrophosphate, e.g., ank and PC-1; however, periodontal effects of these mutations have not previously been examined. These initial studies using ank and PC-1 mutant mice were done to see if such mineral deposition and resulting ankylosis were occurring in the periodontium as well. Surprisingly, results indicated the absence of ankylosis; however, a marked increase in cementum formation on the root surfaces of fully developed teeth of these mutant mice was noted. Examination of ank mutant mice at earlier ages of tooth root formation indicated that this striking observation is apparent from the onset of cementogenesis. These findings suggest that cells within the periodontal region are highly responsive to changes in phosphate metabolism. This information may prove valuable in attempts to design successful therapies for regenerating periodontal tissues.

KEY WORDS: cementum • phosphate (P_i) • pyrophosphate (PP_i) • mineralization

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Examination of developing periodontal tissues from tissue non-specific alkaline phosphatase (TNAP) mutant mice has highlighted the importance of local expression of this enzyme for the initiation of cementogenesis (Beertsen et al., 1999). In these mice, and in the human counterpart (Chapple, 1993), there is a defective formation of acellular cementum along the tooth root. Additionally, in these mice with low levels of TNAP (the condition hypophosphatasia in humans), extracellular pyrophosphate levels rise, and they exhibit a significant decrease in bone mineralization and rickets-like symptoms as a skeletal phenotype (Fedde et al., 1999). Although the exact function of TNAP has not been determined, one hypothesis is that TNAP activity stimulates the breakdown of pyrophosphate, a potent inhibitor of hydroxyapatite mineral deposition (Fleish, 1981).

The dramatic inhibitory effect of TNAP deficiency on cementum formation prompted us to investigate mice presenting mutations in the ank gene and in plasma cell membrane glycoprotein-1 (PC-1). The ank mutant mice present an autosomal-recessive inheritance of a single base substitution mutation in mouse chromosome 15 (Ho et al., 2000). Overexpression of the wild-type ank gene in cultured cells results in decreased intracellular and increased extracellular PP_i concentrations (Ho et al., 2000). The tiptoe walking (ttw) mice (Sakamoto et al., 1994; Okawa et al., 1998) present an autosomal-recessive inheritance of a naturally occurring non-sense truncation mutation in the PC-1 gene, a membrane-bound ectoenzyme that can generate PP_i from extracellular nucleoside triphosphates and, consequently, similar to the ank mutant mice, also present a low extracellular PP_i level (Johnson et al., 1999).

A similar phenotype has been described for both mutations, e.g., hydroxyapatite crystal development on articular surfaces and in synovial fluid of mutant mice, accompanied by joint space narrowing, cartilage erosion, and formation of bony outgrowths or osteophytes that cause fusion (ankylosis) and joint immobility (Sweet and Green, 1981; Okawa et al., 1998).

The dramatic differences in skeletal mineralization between TNAP and ank/PC-1 mutant mice led us to test whether these differences were also noted within the periodontium. TNAP null mice, which present decreased extracellular P_i, exhibit a lack of cementum, which correlates with their lack of normal mineral formation in the skeleton (Beertsen et al., 1999). We hypothesized that the skeletal ankylosis seen in ank/PC-1 mice might also have a correlate in the periodontium, e.g., tooth ankylosis. Although no ankylosis was seen in these mice, mutations in either the ank or PC-1 gene led to a significant increase in cementum formation. These results suggest that the process of cementum formation is particularly sensitive to changes in pyrophosphate and phosphate metabolism, and that manipulation of ank or PC-1 activity may prove to be a useful way to stimulate formation of this tissue.

	MATERIALS & METHODS

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Ank Mutant Mice
Breeder pairs (heterozygote x heterozygote) of ank mutant mice (strain name, C3FeB6-A/A^w-J-ank) were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). To determine the genotype of the mice, we isolated tail DNA. The ank mutation disrupts a HinfI site in the genome, so DNA from this area was amplified (37 cycles: 94°C for 40 sec, 60°C for 1 min, and 72°C for 40 sec) with specific primers TGCCATCCCTTGCTGATCTG and TGTCGCCATCATTTCTCACCTG. The products of amplification were then digested with HinfI and run on a gel for the determination of genotype.

PC-1 Mutant Mice
A tiptoe walking mouse (PC-1 mutant/ttw), at 5 wks of age, was purchased from the Central Institute for Experimental Animals (Kanagawa, Japan). The phenotype was confirmed by radiographs showing characteristic heterotopic ossification (Hosoda et al., 1981).

Tissue Preparation
All procedures were approved by the University of Michigan Committee on Use and Care of Animals, the Hiroshima University, and the Stanford University Institutional Animal Care and Use Committee for these respective institutions, in compliance with State and Federal Laws. Neonatal ank mutant, heterozygous, and wild-type mice were killed by carbon dioxide inhalation at developmental days 24, 28, 35, 45, and 52, and the PC-1 mutant mice (ttw) at developmental day 77 (vaginal plug = day 0). Mandibles were dissected from surrounding tissues and then hemisected into right and left halves by incision through the midline symphysis. Tissues were immediately immersed in Bouin's fixative (0.9% picric acid, 9% v/v formaldehyde, and 5% acetic acid; Polysciences, Warrington, PA, USA) for 24 hrs, then placed in 70% ethanol. Tissues at or beyond day 27 of development were demineralized in acetic acid and formal saline (4% formaldehyde in 0.85% NaCl + 10% acetic acid) until an acceptable radiographic end-point was achieved (generally 1-5 days). Bucco-lingual paraffin serial sections (7 µm) from 1st molars were prepared and stained with hematoxylin and eosin.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
General Observations
Cementum from ank mutant mice showed an unusual sequence of formative events when compared with tissues from wild-type and heterozygous littermates. Enamel and dentin formation did not seem to be altered in ank mutants. Similarly, the PDL seemed to develop normally, as did the surrounding alveolar bone. However, ank mutants consistently developed an enormous amount of cementum, predominantly the cellular type. This increased cementum formation was apparent at all ages examined, although mutants became more divergent from wild-type and heterozygous littermates as development proceeded.

Histological Observations
    Developmental Day 24
At this stage, root formation has not yet been initiated. No differences were noted in crown development, e.g., enamel and dentin formation, between ank mutant mice and their littermates.

    Developmental Day 28
By day 28, disruption of the epithelial root sheath was seen, and a layer of acellular extrinsic fiber cementum had begun to form along the root of the developing molars. At this time point, i.e., initiation of cementum formation, a thicker cementum layer was noted in tissues from ank mutant mice vs. tissues from wild-type or heterozygous mice (Fig. 1).

View larger version (133K): [in this window] [in a new window]   Figure 1. Histological aspects of developing teeth at different stages (days 28, 35, and 45) from wild-type (WT) and ank mutant mice (MUT). A thicker layer of cementum was observed from day 28 (arrows), while the bone (B) and periodontal ligament region (P) appeared similar between WT and MUT mice. The difference in the cementum formation between WT and MUT was more evident at day 35 (arrows). By day 45, cementum thickness in MUT mice (*) was markedly increased compared with that in WT mice, indicating the increasingly divergent rates of cementogenesis between the two. In contrast, the PDL region, alveolar bone, and dentin (D) appeared similar between WT and MUT mice. (40X, bar = 100 µm).

    Developmental Day 52
Tooth formation was complete. No ectopic mineral formation was noted within the periodontal ligament region, and the surrounding alveolar bone appeared comparable with that observed in tissues from wild-type mice. Furthermore, the PDL thickness and fiber arrangement did not exhibit significant differences in tissue samples from all three groups. However, an enormous amount of cementum, approximately 10-fold greater than in wild-type littermates, was observed on the root surfaces of both incisors (not shown) and molars of tissues from ank mutant mice. Under light microscope magnification, the cementum appeared cellular, with PDL fibers (Sharpey's fibers) inserted into the formed cementum.

    PC-1 Mutant Mice
A similar cementum phenotype was observed for the PC-1 mutant mouse at day 77, with a markedly increased amount of cementum when compared with tissues from age-matched controls. Similar to the ank mutant mouse, the PDL region and the alveolar bone in this animal appeared to be normally developed, and presented similar histological aspects when compared with ank mutant, wild-type, and heterozygous mice (Fig. 2).

View larger version (57K): [in this window] [in a new window]   Figure 2. At later stages, the PC-1 and ank mutant mice (days 77 and 52, respectively) showed histological similarities in alveolar bone (B), the periodontal ligament region (P), and cementum (*). Cementum appeared to be predominantly cellular, and markedly thicker than in wild-type mice. (20X, bar = 200 µm).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

Pyrophosphate has been identified as a natural inhibitor of crystal formation in fluids outside cells, and is used therapeutically to control crystal growth (Fleisch, 1981; Rodan, 1998; Terkeltaub et al., 1998; Terkeltaub, 2001). There are several cell membrane proteins that are known to control extracellular PP_i (ePP_i) levels and thereby influence the extent of mineralization. These include ANK, which regulates intracellular to extracellular movement of PP_i; PC-1, the PP_i-generating phosphodiesterase nucleotide triphosphate pyrophosphatase family isoenzyme plasma membrane glycoprotein-1; and TNAP, a PP_i-ase (Terkeltaub, 2001). Mice and their human counterparts lacking activity of ANK, PC-1, and TNAP display significant disruption in mineralization of tissues, including those of the periodontium (Beertsen et al., 1999). The ttw (tip-toe walking) mice have a non-sense mutation in PC-1, a membrane-bound ectoenzyme that generates PPi from extracellular nucleoside triphosphates (Okawa et al., 1998). Extensive studies on this enzyme by Terkeltaub and co-workers indicate that it has an important role in maintaining levels of extracellular, and perhaps intracellular, PP_i (Terkeltaub et al., 1994). Ttw mice develop excess calcification in ligaments of the axial skeleton, resulting in myelopathy and abnormal gait. Additionally, mutated PC-1 and decreased ePP_i levels have been identified in a patient affected with severe peri-articular and vascular calcification (Caswell et al., 1987; Huang et al., 1994; Terakado et al., 1995; Rutsch et al., 2000, 2001).

As discussed in the INTRODUCTION, ank mutant mice exhibit a phenotype similar to that of ttw mice (Sweet and Green, 1981). Kingsley's group identified the mutation responsible for this phenotype, and further showed that the defect was linked to abnormal suppression of ePP_i due to the loss of function of the protein ANK (Ho et al., 2000). ANK is a 54-kDa protein that appears to play a crucial role in controlling local levels of PP_i. Skin fibroblasts from ank mutant mice contain excess intracellular PP_i and exhibit little ePPi when compared with cells from wild-type mice.

In contrast to the roles of ANK and PC-1 in contributing to increased levels of ePP_i, the enzyme TNAP hydrolyzes ePP_i to increase the levels of extracellular P_i. TNAP mutant and knockout mice exhibit areas of hypomineralization associated with spontaneous fractures (Narisawa et al., 1997; Fedde et al., 1999). The equivalent human condition, hypophosphatasia, is a heritable disease manifested by rickets and osteomalacia, with subnormal levels of serum TNAP activity. In mice and humans with loss of TNAP function, one notes little or no formation of cementum (acellular in mice). Additionally, there appears to be a direct correlation between local levels of TNAP and thickness of cementum (Groeneveld et al., 1995).

In the present study, striking differences were noted in cementum between roots from ank mutants and those from heterozygous and wild-type mice, and this increase in cementum formation in ank mutant mice was noted at the start of cementogenesis, becoming more apparent as root development continued. In fully developed tooth roots (day 52), cementum thickness in ank mutant mice was increased greater than 10-fold. In contrast, PDL and surrounding alveolar bone appeared normal, i.e., similar to that of heterozygous and wild-type littermates. Analysis of these data suggests that cells involved in cementogenesis, i.e., cells along the root surface, cementoblasts, are specifically sensitive to levels of PP_i/P_i within the extracellular matrix vs. cells involved in the formation of the surrounding alveolar bone, i.e., osteoblasts (Fig. 3).

View larger version (34K): [in this window] [in a new window]   Figure 3. Proposed model for cementum formation: control of PPi/Pi locally is critical for development of a functional periodontium. An increased ratio of PPi/Pi results in minimal cementum (cem) formation, and exfoliation of teeth in humans. In contrast, lack of PPi, e.g., ank and PC-1 mutant mice, appears to favor cementum formation with normal development of the PDL region and bone.

	ACKNOWLEDGMENTS

 
This work was supported in part by NIH grant DE09532 (MJS). Kyle Gurley was supported by a pre-doctoral fellowship from the Howard Hughes Medical Institute. David Kingsley is an Associate Investigator of the Howard Hughes Medical Institute. Drs. T. Takata and M. Miyauchi are supported by JSPS Grants 11470378 and 14370583.

Received July 10, 2002; Last revision September 20, 2002; Accepted September 23, 2002

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Aberg T, Wozney J, Thesleff I (1997). Expression patterns of bone morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles in morphogenesis and cell differentiation. Dev Dyn 210:383–396.[Medline]

Beertsen W, VandenBos T, Everts V (1999). Root development in mice lacking functional tissue non-specific alkaline phosphatase gene: inhibition of acellular cementum formation. J Dent Res 78:1221–1229.[Abstract/Free Full Text]

Bosshardt DD, Nanci A (1997). Immunodetection of enamel- and cementum-related (bone) proteins at the enamel-free area and cervical portion of the tooth in rat molars. J Bone Miner Res 12:367–379.[Medline]

Bosshardt DD, Selvig KA (1997). Dental cementum: the dynamic tissue covering of the root. Periodontol 2000 13:41–75.

Caswell AM, Ali SY, Russell RG (1987). Nucleoside triphosphate pyrophosphatase of rabbit matrix vesicles, a mechanism for the generation of inorganic pyrophosphate in epiphyseal cartilage. Biochim Biophys Acta 924:276–283.[Medline]

Chapple IL (1993). Hypophosphatasia: dental aspects and mode of inheritance. J Clin Periodontol 20:615–622.[Medline]

D'Errico JA, MacNeil RL, Takata T, Berry J, Strayhorn C, Somerman MJ (1997). Expression of bone associated markers by tooth root lining cells, in situ and in vitro. Bone 20:117–126.[Medline]

Fedde KN, Blair L, Silverstein J, Coburn SP, Ryan LM, Weinstein RS, et al. (1999). Alkaline phosphatase knock-out mice recapitulate the metabolic and skeletal defects of infantile hypophosphatasia. J Bone Miner Res 14:2015–2026.[Medline]

Fleisch H (1981). Diphosphonates: history and mechanisms of action. Metab Bone Dis Relat Res 3:279–287.[Medline]

Groeneveld MC, Everts V, Beertsen W (1995). Alkaline phosphatase activity in the periodontal ligament and gingiva of the rat molar: its relation to cementum formation. J Dent Res 74:1374–1381.[Abstract/Free Full Text]

Ho AM, Johnson MD, Kingsley DM (2000). Role of the mouse ank gene in control of tissue calcification and arthritis. Science 289:265–270.[Abstract/Free Full Text]

Hosoda Y, Yoshimura Y, Higaki S (1981). A new breed of mouse showing multiple osteochondral lesions—twy mouse. Ryumachi 21(Suppl):157–164.

Huang Z, Bodkin NL, Ortmeyer HK, Hansen BC, Shuldiner AR (1994). Hyperinsulinemia is associated with altered insulin receptor mRNA splicing in muscle of the spontaneously obese diabetic rhesus monkey. J Clin Invest 94:1289–1296.

Johnson K, Moffa A, Chen Y, Pritzker K, Goding J, Terkeltaub R (1999). Matrix vesicle plasma cell membrane glycoprotein-1 regulates mineralization by murine osteoblastic MC3T3 cells. J Bone Miner Res 14:883–892.[Medline]

Narisawa S, Frohlander N, Millan JL (1997). Inactivation of two mouse alkaline phosphatase genes and establishment of a model of infantile hypophosphatasia. Dev Dyn 208:432–446.[Medline]

Okawa A, Ikegawa S, Nakamura I, Goto S, Moriya H, Nakamura Y (1998). Mapping of a gene responsible for twy (tip-toe walking Yoshimura), a mouse model of ossification of the posterior longitudinal ligament of the spine (OPLL). Mamm Genome 9:155–156.[Medline]

Rodan GA (1998). Mechanisms of action of bisphosphonates. Annu Rev Pharmacol Toxicol 38:375–388.[Medline]

Rutsch F, Schauerte P, Kalhoff H, Petrarulo M, August C, Diekmann L (2000). Low levels of urinary inorganic pyrophosphate indicating systemic pyrophosphate deficiency in a boy with idiopathic infantile arterial calcification. Acta Paediatr 89:1265–1269.[Medline]

Rutsch F, Vaingankar S, Johnson K, Goldfine I, Maddux B, Schauerte P, et al. (2001). PC-1 nucleoside triphosphate pyrophosphohydrolase deficiency in idiopathic infantile arterial calcification. Am J Pathol 158:543–554.[Abstract/Free Full Text]

Sakamoto M, Hosoda Y, Kojimahara K, Yamazaki T, Yoshimura Y (1994). Arthritis and ankylosis in twy mice with hereditary multiple osteochondral lesions: with special reference to calcium deposition. Pathol Int 44:420–427.[Medline]

Schroeder HE (1992). Biological problems of regenerative cementogenesis: synthesis and attachment of collagenous matrices on growing and established root surfaces. Int Rev Cytol 142:1–59.[Medline]

Sweet HO, Green MC (1981). Progressive ankylosis, a new skeletal mutation in the mouse. J Hered 72:87–93.[Abstract/Free Full Text]

Takahashi H, Ikeda T (1996). Transcripts for two members of the transforming growth factor-beta superfamily BMP-3 and BMP-7 are expressed in developing rat embryos. Dev Dyn 207:439–449.[Medline]

Terakado A, Tagawa M, Goto S, Yamazaki M, Moriya H, Fujimura S (1995). Elevation of alkaline phosphatase activity induced by parathyroid hormone in osteoblast-like cells from the spinal hyperostotic mouse TWY (twy/twy). Calcif Tissue Int 56:135–139.[Medline]

Terkeltaub RA (2001). Inorganic pyrophosphate generation and disposition in pathophysiology. Am J Physiol Cell Physiol 281:C1–C11.[Abstract/Free Full Text]

Terkeltaub R, Rosenbach M, Fong F, Goding J (1994). Causal link between nucleotide pyrophosphohydrolase overactivity and increased intracellular inorganic pyrophosphate generation demonstrated by transfection of cultured fibroblasts and osteoblasts with plasma cell membrane glycoprotein-1. Relevance to calcium pyrophosphate dihydrate deposition disease. Arthritis Rheum 37:934–941.[Medline]

Terkeltaub RA, Johnson K, Rohnow D, Goomer R, Burton D, Deftos LJ (1998). Bone morphogenetic proteins and bFGF exert opposing regulatory effects on PTHrP expression and inorganic pyrophosphate elaboration in immortalized murine endochondral hypertrophic chondrocytes (MCT cells). J Bone Miner Res 13:931–941.[Medline]

Wise GE (1998). The biology of tooth eruption. J Dent Res 77:1576–1579.[Free Full Text]

Wise GE, Lin F, Zhao L (1995). Transcription and translation of CSF-1 in the dental follicle. J Dent Res 74:1551–1557.[Abstract/Free Full Text]

Wise GE, Huang H, Que BG (1999). Gene expression of potential tooth eruption molecules in the dental follicle of the mouse. Eur J Oral Sci 107:482–486.[Medline]

This article has been cited by other articles:

				W. N. Addison, F. Azari, E. S. Sorensen, M. T. Kaartinen, and M. D. McKee Pyrophosphate Inhibits Mineralization of Osteoblast Cultures by Binding to Mineral, Up-regulating Osteopontin, and Inhibiting Alkaline Phosphatase Activity J. Biol. Chem., May 25, 2007; 282(21): 15872 - 15883. [Abstract] [Full Text] [PDF]

				R.B. Rutherford, B.L. Foster, T. Bammler, R.P. Beyer, S. Sato, and M.J. Somerman Extracellular phosphate alters cementoblast gene expression. J. Dent. Res., June 1, 2006; 85(6): 505 - 509. [Abstract] [Full Text] [PDF]

				T. van den Bos, G. Handoko, A. Niehof, L.M. Ryan, S.P. Coburn, M.P. Whyte, and W. Beertsen Cementum and Dentin in Hypophosphatasia J. Dent. Res., November 1, 2005; 84(11): 1021 - 1025. [Abstract] [Full Text] [PDF]

				C. M. Giachelli, M. Y. Speer, X. Li, R. M. Rajachar, and H. Yang Regulation of Vascular Calcification: Roles of Phosphate and Osteopontin Circ. Res., April 15, 2005; 96(7): 717 - 722. [Abstract] [Full Text] [PDF]

This Article Abstract Figures Only Full Text (PDF) Services Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (17) Citing Articles via Google Scholar Google Scholar Articles by Nociti, F.H. Articles by Somerman, M.J. Search for Related Content PubMed PubMed Citation Articles by Nociti, F.H., Jr. Articles by Somerman, M.J.