HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Figures Only Full Text (PDF) Services Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Tsuruga, E. Articles by Yajima, T. Search for Related Content PubMed PubMed Citation Articles by Tsuruga, E. Articles by Yajima, T.

Gene Expression and Accumulation of Fibrillin-1, Fibrillin-2, and Tropoelastin in Cultured Periodontal Fibroblasts

Department of Oral Anatomy, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Tobetsu, Hokkaido 061-0293, Japan;

* corresponding author, tsuru{at}hoku-iryo-u.ac.jp

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
The elastic system fibers consist of three types—oxytalan, elaunin, and elastic fibers—differing in their relative microfibril and elastin contents. All three types are found in human gingiva, but human periodontal ligaments contain only elastin-free fibers. We examined cultured human gingival fibroblasts (HGF) and cultured human periodontal ligament fibroblasts (HPLF) to determine the gene expression of fibrillin-1 and fibrillin-2 (the major components of microfibrils) and of tropoelastin. In addition, we assessed the degree of accumulation of these proteins in the extracellular matrix. Northern blot analysis revealed that the level of expression of fibrillin-1 and fibrillin-2 was higher in HGF than in HPLF. However, examination of matrix samples from HGF and HPLF cell layers showed that there was no difference in fibrillin-1 accumulation, although fibrillin-2 accumulated to a much greater extent in the HGF-derived matrix. Tropoelastin was expressed only in and around HGF. These results show a correlation between gene expression and the accumulation of tropoelastin and fibrillin-2 in HGF.

KEY WORDS: elastogenesis • fibrillin • gingiva • periodontal ligaments • matrix

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
The elastic system fibers are an integral part of the extracellular matrices found in various structures, such as the aorta, lung, and skin (Rosenbloom et al., 1993). Their function is to provide resilience and elasticity. The fibers are composed of microfibrils and elastin (Mecham and Davis, 1994), and they can be classified into three types depending upon their relative contents of these components. Elastic fibers contain a high proportion of elastin, while elaunin fibers contain very little elastin, and oxytalan fibers are bundles of pure microfibrils (Böck and Stockinger, 1984).

Microfibrils are predominantly composed of two 350-kDa glycoproteins, fibrillin-1 and fibrillin-2 (Sakai et al., 1986; Zhang et al., 1994). Fibrillin-containing microfibrils are widely distributed throughout the body, either in association with elastin or in elastin-free bundles (Sakai et al., 1991; Zhang et al., 1995; Keene et al., 1997). The only components of the elastic system fibers that can be recognized in human periodontal ligaments are oxytalan fibers (Sculean et al., 1999), whereas all three types of fiber are found in human gingiva (Chavrier et al., 1988). Recently, we have reported that cultured human gingival fibroblasts (HGF) secrete both fibrillins and tropoelastin into the medium, whereas human periodontal ligament fibroblasts (HPLF) secrete only fibrillins (Tsuruga et al., 2002a). In addition, we have demonstrated that the different tropoelastin expression patterns reflect the difference in the phenotypes of HGF and HPLF (Tsuruga et al., 2002b). However, the matrix component of elastic system fibers is extremely difficult to extract due to its insolubility, so the biochemical characteristics of fibroblast cell layers remain poorly understood. In addition, no published analyses have compared the levels of the two fibrillins in elastic and elastin-free culture systems. Therefore, in the present study, we initially compared the levels of gene expression of fibrillin-1, fibrillin-2, and tropoelastin in HGF and HPLF. Subsequently, we investigated the accumulation of the three proteins within the matrix.

	MATERIALS & METHODS

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Cells and Culture
The study protocol had been reviewed and approved by the Health Sciences University of Hokkaido Research Ethics Committee. Informed consent was obtained from the tissue donors.

HGF and HPLF were isolated and cultured as described previously (Giannopoulou and Cimasoni, 1996). To summarize: The cells were harvested from the healthy gingiva and PDL of three different volunteers (ages 17, 19, and 20 yrs) who were undergoing extraction of a molar for orthodontic reasons. The cells were then cultured at 37°C in humidified air containing 5% CO₂ in Minimum Essential Medium (MEM; ICN Biomedicals Inc., Aurora, OH, USA) supplemented with non-essential amino acids (ICN Biomedicals Inc.) and 10% newborn calf serum (NCS; Life Technologies, Grand Island, NY, USA). Prior to use, the cells were trypsinized and seeded in 60-mm culture dishes at a density of 1 x 10⁶ cells/dish (Corning Co., Cambridge, MA, USA). The culture medium consisted of MEM supplemented with non-essential amino acids, 10% NCS, 100 U/mL penicillin, and 100 µg/mL streptomycin. The medium was collected and refreshed (5 mL/dish) every 3 days during the culture process. Cells were sampled from the third to the fifth passages of the culture procedure. Three separate samples of each subject’s HGF and HPLF cells were compared. These had all been obtained from the same cell culture passage. All intrasubject comparisons yielded similar results for each experiment.

RNA Isolation and Northern Blot Analysis
Total RNA was prepared from the cultured HGF and HPLF at 2, 4, and 6 wks after reaching confluence, with the use of the RNeasy MiniKit (Qiagen, Hilden, Germany). One microgram of RNA was subjected to Northern blot analysis, which was performed as described previously (Tsuruga et al., 2002b). To generate probes for human fibrillin-1 and fibrillin-2, we obtained templates using reverse-transcription/polymerase chain-reaction (RT-PCR) and RNA extracted from HGF, which have previously been shown to produce significant amounts of both fibrillins (Tsuruga et al., 2002a). PCR was carried out in 50 µL buffer (10 mM Tris-HCl [pH 8.7], 50 mM KCl, 1.5% Triton X-100, and 1.5 mM MgCl₂) containing 100 ng of prepared cDNA as the template, 2.5 U HotStarTag DNA Polymerase (Qiagen), 200 µM of each dNTP, and 100 pM of each primer. The primer sequences used for PCR were (reading from 5' to 3'): fibrillin-1, forward, CCCAAGCTTGGAGAAGCACAAACCAAACT, and reverse, GGAATTCCCCCAATGGAAATACACGTC; and fibrillin-2, forward, CCCAAGCTTTCAGCCTAGAGAGTGTCGAC, and reverse, GGAATTCAATACAGTAACCACGGTTGC. Both of these primer sequences have been reported previously (Lee et al., 1991; Maslen et al., 1991; Zhang et al., 1994). The PCR products were ligated into the pT7/T3-18 vector (Life Technologies). The plasmid was linearized with Hind III and then T7 RNA polymerase mixed with digoxigenin (DIG)-labeled nucleotides (Roche Molecular Biochemicals, Mannheim, Germany) to generate the DIG-labeled 698-bp fibrillin-1 and 583-bp fibrillin-2 RNA probes. To ensure specificity, we included in the probes two cDNA inserts that cover the 3' non-coding regions of the two fibrillins (which show only 6% homology), as reported previously (Zhang et al., 1994). A DIG-labeled 1.1-kb human tropoelastin RNA probe was also generated as described previously (Tsuruga et al., 2002b). Small variations in RNA loading were corrected by normalization relative to the intensity of a band obtained by re-probing the membrane with a DIG-labeled ß-actin RNA probe (Roche Molecular Biochemicals). Densitometric analysis of the signals was performed with use of the NIH Image program (National Institutes of Health, Bethesda, MD, USA).

Protein Extraction and Western Blot Analysis
The following method was used to collect protein from the matrices of the cell layers. HGF and HPLF cell layers that had been cultured for 2, 4, and 6 wks were washed three times with serum-free MEM, homogenized in a 200 µL/60-mm dish of 50 mM Tris (pH 7.4) containing 1% Triton X-100 and a protease inhibitor cocktail (5 mM ethylenediaminetetraacetic acid, 50 µM N-ethylmaleimide, and 50 µM phenylmethylsulfonyl fluoride), and centrifuged at 16,000 x g for 30 min at 4°C. The supernatant, which included the cellular fraction, is henceforward referred to as the "cellular" sample. The residue, which included the extracellular matrix, was washed with phosphate-buffered saline (PBS) containing the protease inhibitors cocktail and divided into equal portions. One of these portions was used for the extraction of microfibrils, the other for the extraction of soluble elastin. To extract the microfibrils, we homogenized the residue overnight in 5 M guanidine-HCl and 50 mM Tris (pH 7.4) containing the protease inhibitors, then centrifuged it at 15,000 x g for 30 min. The supernatant was dialyzed against distilled water and lyophilized (matrix sample 1). To extract soluble elastin, we used the methods described by Chipman et al. (1985). Briefly, the other half of the residue was homogenized with 2 mL of 0.5 M ammonium sulfate (pH 7.0) containing the protease inhibitors, and then centrifuged at 15,000 x g for 30 min. The supernatant was removed, then the pellet was re-suspended in one-half volume of ammonium sulfate buffer and re-centrifuged. The supernatants from the first and second centrifugations were combined, dialyzed against distilled water, and lyophilized. The lyophilized material was dissolved in PBS at a concentration of 5 mg/mL, and then solid ammonium sulfate was slowly added to achieve a final concentration of 40%. The resulting precipitate was collected by centrifugation, solubilized in 0.5 M ammonium formate (pH 5.5), and dialyzed overnight against the same buffer containing the proteinase inhibitors. One and one-half volumes of 1-propanol were then added dropwise to one volume of the ammonium formate-protein solution, followed by dropwise addition of 2.5 volumes of 1-butanol. After being stirred overnight, the material was filtered, and the filtrate was dried, washed with chloroform, and solubilized in 0.02 N formic acid. The formic acid solution was dialyzed against 0.02 N formic acid (pH 3.5) and lyophilized (matrix sample 2).

Aliquots (100 µg) of the "cellular" and "matrix" samples were subjected to sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 5 or 10% gels and transferred to Immobilon-P membranes (Millipore, Bedford, MA, USA). The blots were blocked with TBST (20 mM Tris [pH 7.5], 500 mM NaCl, and 0.1% Tween-20) containing 4% non-fat skim milk (TBST/SM) for 2 hrs at room temperature, then incubated overnight at 4°C with the appropriate anti-human polyclonal primary antibody (fibrillin-1 and fibrillin-2, 1:2000 dilution; tropoelastin, 1:500 dilution; all purchased from Elastin Products Co., Owensville, MO, USA). We had already confirmed the specificity of the fibrillin-1 and fibrillin-2 antibodies as reported previously (Tsuruga et al., 2002a). In this previous study, immunoprecipitation was performed with each of the two antibodies from the HGF culture medium. The immunoprecipitated materials were analyzed by Western blotting for confirmation that the distinct proteins could be differentiated by use of the two antibodies. The blots were then washed with TBST/SM and incubated with horseradish peroxidase-conjugated sheep anti-rabbit Ig(F[ab']₂) (Amersham Pharmacia Biotech, Piscataway, NJ, USA) for 1 hr at room temperature, after which they were washed with TBST/SM and developed in an enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Little Chalfont, UK). The blots were exposed to x-ray film so that the proteins could be visualized.

To ensure equal loading in each lane, we stained the hybridized membrane with 0.1% (w/v) Amido Black 10B (Wako Pure Chemicals, Osaka, Japan), 10% acetic acid, and 20% methanol, and subsequently de-stained it with 10% acetic acid.

Pre-stained SDS-PAGE molecular-weight markers (Bio-Rad Laboratories, Hercules, CA, USA) were run with each blot. The protein content was quantified by means of the BCA protein assay system (Pierce Chemical Co., Rockford, IL, USA).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Gene Expression Levels of Fibrillin-1, Fibrillin-2, and Tropoelastin
One microgram of total RNA was extracted from the HGF and HPLF after 2, 4, and 6 wks of culture. The RNA sample was blotted and hybridized with the fibrillin-1, fibrillin-2, and tropoelastin RNA probes (Fig. 1A). Changes in the intensities of the signals were compared, with ß-actin mRNA signals serving as an internal control (Fig. 1B). Densitometric analysis showed fibrillin-1 levels in the HGF to be about twice as high as those in the HPLF. Similarly, the fibrillin-2 level in the HGF had increased eight-fold up to 4 wks, while the HPLF showed a slower rate of increase, with a four-fold rise up to 4 wks. Slight tropoelastin expression was evident in the HGF at 2 wks, and this increased markedly up to 4 wks, corresponding to the increase in fibrillin-2. In contrast, HPLF produced no detectable tropoelastin signals.

View larger version (31K): [in this window] [in a new window]   Figure 1. Fibrillin-1, fibrillin-2, and tropoelastin mRNA expression in human gingival fibroblasts (HGF) and human periodontal ligament fibroblasts (HPLF). (A) Northern blot analysis. HGF and HPLF were harvested at the time-points indicated. Total cell RNA was extracted, and 1 µg was analyzed by Northern blotting analysis as described in MATERIALS & METHODS. (B) Densitometric analysis of the time-course of changes in the levels of expression of fibrillin-1, fibrillin-2, and tropoelastin mRNA, measured as shown in (A). All mRNA expression levels were analyzed with the use of National Institutes of Health imaging software and were normalized relative to ß-actin mRNA expression. The levels of expression in the HGF two-week culture samples were arbitrarily assigned the value of 1. The results represent the means + SD (standard deviation) of three independent experimental determinations.

Examination of the "matrix" samples showed that fibrillin-1 was first detectable at 4 wks, and that by 6 wks the densities of fibrillin-1 were almost equal in the HGF and HPLF samples (Fig. 2A). Fibrillin-2 appeared at 4 wks in the HGF matrix samples, but could not be detected in HPLF samples at this time. By 6 wks, samples from the HGF culture showed a marked increase in density of fibrillin-2 compared with those from the HPLF culture (Fig. 2B). A stable stained band corresponding to tropoelastin was identified only in the HGF samples, and this is consistent with the results of the Northern blotting analysis (Fig. 2C).

View larger version (46K): [in this window] [in a new window]   Figure 2. Immunodetection of fibrillin-1, fibrillin-2, and tropoelastin in matrix samples from HGF and HPLF cell layers after 2, 4, and 6 wks of culture. Equal amounts of matrix samples (100 µg) that had been harvested from HGF and HPLF cell layers after 2, 4, and 6 wks of culture were separated by SDS-PAGE and transferred to Immobilon-P membranes. The blots were probed with anti-fibrillin-1 (A), anti-fibrillin-2 (B), and anti-tropoelastin (C) antibodies. To ensure that equivalent amounts of the extracted proteins were present in each lane, we stained another membrane with Amido Black 10B reagent before hybridization (lower panel in A, B, and C). The results are representative of the three independent experiments. The positions of the size markers are indicated on the right. Densitometric scanning of the bands was performed with the use of National Institutes of Health imaging software.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
The assembly of elastic fibers has often been studied ultrastructurally by the use of fetal auricular cartilage, lung, and aorta cells, because of the ability of chondroblasts, pulmonary fibroblasts, and smooth-muscle cells to product elastin (Campagnone et al., 1987; Mecham, 1987; Faris et al., 1992). However, few biochemical studies have been carried out on microfibrils and elastin in the extracellular matrices of cell layers, since it is difficult to solubilize the matrix into its molecular components. In particular, it is difficult to extract both microfibrils and tropoelastin from tissue at the same time (Cleary and Gibson, 1983). Indeed, in our preliminary experiments, tropoelastin could not be detected in matrix sample 1 (the microfibril-containing fraction), and fibrillins could not be found in matrix sample 2 (the tropoelastin-containing fraction) by Western blotting (data not shown). Nevertheless, it seems reasonable to use two separate methods to extract the microfibril-containing and the tropoelastin-containing fractions from the cell layers, and this was the approach that we subsequently adopted.

In the present study, we used HGF and HPLF cell cultures as a model to investigate the accumulation of microfibril and elastin in the extracellular matrices of the cell layers. Recently, we have demonstrated that HGF secrete fibrillins and tropoelastin, while HPLF secrete only fibrillins (Tsuruga et al., 2002a). This model therefore has the advantage of being able to distinguish between cells which do and do not produce elastin.

The developmental expression of fibrillin-1 and fibrillin-2, during embryogenesis in mice, has been studied by in situ hybridization and immunohistochemistry (Zhang et al., 1994, 1995). Hurle et al. (1994) have also assessed the expression of fibrillins during elastogenesis in the embryonic chicken heart. The in situ hybridization study indicated that expression patterns of fibrillin-1 and fibrillin-2 broadly overlap. However, there are regional differences as to where they accumulate in the tissues. As a result, it was proposed that fibrillin-1 is associated with late morphogenesis, while fibrillin-2 is linked with the earlier process of elastogenesis (Zhang et al., 1995; Ramirez and Pereira, 1999). Recently, Trask et al. (2000) have identified the tropoelastin-binding site of the fibrillins. By binding to tropoelastin, the fibrillins are thought to optimize the side-chain alignment of tropoelastin, thus facilitating efficient cross-linking during elastic fiber assembly (Brown-Augsburger et al., 1995; Trask et al., 2000). It would therefore appear worthwhile to undertake biochemical investigations into the accumulation of fibrillin-1 and fibrillin-2 in the extracellular matrices of cells that can and cannot produce elastin. The present study has shown that fibrillin-1 accumulates to the same extent, regardless of the elastin-producing capability of a particular cell, whereas fibrillin-2 accumulates preferentially around elastin-producing cells. We have previously found ultrastructural evidence that microfibrils with elastin deposits appear in HGF cell layers within 6 wks (Kunimoto et al., 1999). In these HGF cell layers, the tropoelastin may be laid down preferentially on previously deposited fibrillin-2 rather than on fibrillin-1.

However, there are no reports in the literature that provide evidence of a direct biochemical interaction between tropoelastin and fibrillin-2, rather than fibrillin-1. Indeed, the results from our current study do not support the conclusion that fibrillin-2, rather than fibrillin-1, is associated with elastic fiber assembly. More studies will be needed to clarify the specific functions and significance of fibrillin-1 and fibrillin-2 in regulating the process of elastogenesis. In conclusion, the present study describes, for the first time, gene expression and the accumulation of fibrillins in cultured fibroblasts. We have shown a correlation between gene expression and the accumulation of tropoelastin and fibrillin-2 in HGF. Our findings suggest that fibrillin-1 and fibrillin-2 may have distinct functions in regulating the process of elastogenesis.

	ACKNOWLEDGMENTS

 
We thank Dr. Itaru Mizoguchi (Department of Orthodontics, School of Dentistry, Health Sciences University of Hokkaido) and Dr. Akihiko Tanimura (Department of Dental Pharmacology, School of Dentistry, Health Sciences University of Hokkaido) for helpful discussions. This study was supported in part by the Northern Advancement Center for Science & Technology, the Akiyama Foundation, and a Grant-in-Aid for Scientific Research (No. 14771227) from the Ministry of Education, Science, Sports and Culture of Japan.

Received March 18, 2002; Last revision August 6, 2002; Accepted September 10, 2002

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION REFERENCES

 
Böck P, Stockinger L (1984). Light and electron microscopic identification of elastic, elaunin and oxytalan fibers in human tracheal and bronchial mucosa. Anat Embryol(Berl) 170:145–153.

Brown-Augsburger P, Tisdale C, Broekelmann T, Sloan C, Mecham RP (1995). Identification of an elastin cross-linking domain that joins three peptide chains. Possible role in nucleated assembly. J Biol Chem 270:17778–17783.[Abstract/Free Full Text]

Campagnone R, Regan J, Rich CB, Miller M, Keene DR, Sakai L, et al. (1987). Pulmonary fibroblasts: a model system for studying elastin synthesis. Lab Invest 56:224–230.[Medline]

Chavrier C, Hartmann DJ, Couble ML, Herbage D (1988). Distribution and organization of the elastic system fibres in healthy human gingiva. Ultrastructural and immunohistochemical study. Histochemistry 89:47–52.[Medline]

Chipman SD, Faris B, Barone LM, Pratt CA, Franzblau C (1985). Processing of soluble elastin in cultured neonatal rat smooth muscle cells. J Biol Chem 260:12780–12785.[Abstract/Free Full Text]

Cleary EG, Gibson MA (1983). Elastin-associated microfibrils and microfibrillar proteins. Int Rev Connect Tissue Res 10:97–209.[Medline]

Faris B, Tan OT, Toselli P, Franzblau C (1992). Long-term neonatal rat aortic smooth muscle cell cultures: a model for the tunica media of a blood vessel. Matrix 12:185–188.[Medline]

Giannopoulou C, Cimasoni G (1996). Functional characteristics of gingival and periodontal ligament fibroblasts. J Dent Res 75:895–902.[Abstract/Free Full Text]

Hurle JM, Kitten GT, Sakai LY, Volpin D, Solursh M (1994). Elastic extracellular matrix of the embryonic chick heart: an immunohistological study using laser confocal microscopy. Dev Dyn 200:321–332.[Medline]

Keene DR, Jordan CD, Reinhardt DP, Ridgway CC, Ono RN, Corson GM, et al. (1997). Fibrillin-1 in human cartilage: developmental expression and formation of special banded fibers. J Histochem Cytochem 45:1069–1082.[Abstract/Free Full Text]

Kunimoto H, Fujii S, Irie K, Sakakura Y, Yajima T (1999). Ultrastructural study of the fibrogenesis of elastic system fibers by human gingival fibroblasts in vitro. Jpn J Oral Biol 41:235–244.

Lee B, Godfrey M, Vitale E, Hori H, Mattei MG, Sarfarazi M, et al. (1991). Linkage of Marfan syndrome and a phenotypically related disorder to two different fibrillin genes. Nature 352:330–334.[Medline]

Maslen CL, Corson GM, Maddox BK, Glanville RW, Sakai LY (1991). Partial sequence of a candidate gene for the Marfan syndrome. Nature 352:334–337.[Medline]

Mecham RP (1987). Modulation of elastin synthesis: in vitro models. Methods Enzymol 144:232–246.[Medline]

Mecham R, Davis E (1994). Extracellular matrix assembly and structure. In: Elastic fiber structure and assembly. Yurchenko P, Birk D, Mecham R, editors. New York: Academic Press, pp. 281-314.

Ramirez F, Pereira L (1999). The fibrillins. Int J Biochem Cell Biol 31:255–259.[Medline]

Rosenbloom J, Abrams WR, Mecham R (1993). Extracellular matrix 4: the elastic fiber. FASEB J 7:1208–1218.[Abstract]

Sakai LY, Keene DR, Engvall E (1986). Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils. J Cell Biol 103:2499–2509.[Abstract/Free Full Text]

Sakai LY, Keene DR, Glanville RW, Bachinger HP (1991). Purification and partial characterization of fibrillin, a cysteine-rich structural component of connective tissue microfibrils. J Biol Chem 266:14763–14770.[Abstract/Free Full Text]

Sculean A, Donos N, Windisch P, Reich E, Gera I, Brecx M, et al. (1999). Presence of oxytalan fibers in human regenerated periodontal ligament. J Clin Periodontol 26:318–321.[Medline]

Trask TM, Trask BC, Ritty TM, Abrams WR, Rosenbloom J, Mecham RP (2000). Interaction of tropoelastin with the amino-terminal domains of fibrillin-1 and fibrillin-2 suggests a role for the fibrillins in elastic fiber assembly. J Biol Chem 275:24400–24406.[Abstract/Free Full Text]

Tsuruga E, Irie K, Sakakura Y, Yajima T (2002a). Expression of fibrillins and tropoelastin by human gingival and periodontal ligament fibroblasts in vitro. J Periodontal Res 37:23–28.[Medline]

Tsuruga E, Irie K, Sakakura Y, Yajima T (2002b). Tropoelastin expression by periodontal fibroblasts. J Dent Res 81:198–202.[Abstract/Free Full Text]

Zhang H, Apfelroth SD, Hu W, Davis EC, Sanguineti C, Bonadio J, et al. (1994). Structure and expression of fibrillin-2, a novel microfibrillar component preferentially located in elastic matrices. J Cell Biol 124:855–863.[Abstract/Free Full Text]

Zhang H, Hu W, Ramirez F (1995). Developmental expression of fibrillin genes suggests heterogeneity of extracellular microfibrils. J Cell Biol 129:1165–1176.[Abstract/Free Full Text]

This article has been cited by other articles:

				E. Tsuruga, K. Irie, and T. Yajima Fibrillin-2 Degradation by Matrix Metalloproteinase-2 in Periodontium J. Dent. Res., April 1, 2007; 86(4): 352 - 356. [Abstract] [Full Text] [PDF]

This Article Abstract Figures Only Full Text (PDF) Services Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Tsuruga, E. Articles by Yajima, T. Search for Related Content PubMed PubMed Citation Articles by Tsuruga, E. Articles by Yajima, T.